Transcript: Human NM_019069.4

Homo sapiens WD repeat domain 5B (WDR5B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
WDR5B (54554)
Length:
4217
CDS:
535..1527

Additional Resources:

NCBI RefSeq record:
NM_019069.4
NBCI Gene record:
WDR5B (54554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019069.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117883 CCTTATAATCTCGGGATCTTT pLKO.1 948 CDS 100% 5.625 7.875 N WDR5B n/a
2 TRCN0000117884 GCAACTTTGGACAACACTCTT pLKO.1 1216 CDS 100% 4.950 3.960 N WDR5B n/a
3 TRCN0000215340 CTGGTCATAAGAATGAGAAAT pLKO.1 1280 CDS 100% 13.200 9.240 N Wdr5b n/a
4 TRCN0000117882 GCTGCGATAAACAGCACTATT pLKO.1 2239 3UTR 100% 13.200 9.240 N WDR5B n/a
5 TRCN0000433053 GTGAAATCTGGGCTTAGTATA pLKO_005 1790 3UTR 100% 13.200 9.240 N WDR5B n/a
6 TRCN0000432411 CAGTTAAGTTTAGTCCTAATG pLKO_005 671 CDS 100% 10.800 7.560 N WDR5B n/a
7 TRCN0000117885 ACCCAGTTTCTGCTGTTCATT pLKO.1 1037 CDS 100% 5.625 3.938 N WDR5B n/a
8 TRCN0000117886 GTGCAGAAATTACAAGGCCAT pLKO.1 1402 CDS 100% 2.160 1.296 N WDR5B n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2624 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2589 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2695 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2695 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019069.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03436 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03436 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476307 AGCTGCTTATCGGCATGTAGCCCG pLX_317 36.5% 100% 100% V5 n/a
4 ccsbBroadEn_07746 pDONR223 100% 79.7% 85% None (many diffs) n/a
5 ccsbBroad304_07746 pLX_304 0% 79.7% 85% V5 (many diffs) n/a
6 TRCN0000468790 TTAAATAGCTGAGCCATTCAATTC pLX_317 40.9% 79.7% 85% V5 (many diffs) n/a
Download CSV