Construct: ORF TRCN0000468793
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007960.1_s317c1
- Derived from:
- ccsbBroadEn_04797
- DNA Barcode:
- GAAAGAACTGGCCGTGCGCACTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KRT222 (125113)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468793
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 125113 | KRT222 | keratin 222 | NM_152349.3 | 100% | 100% | |
2 | mouse | 268481 | Krt222 | keratin 222 | NM_172946.3 | 85.8% | 88.4% | (many diffs) |
3 | mouse | 268481 | Krt222 | keratin 222 | NM_001361584.1 | 73.7% | 75.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 67
- ORF end:
- 952
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tntggcatgg aactgtccca gctactcaat gagatcaggg caaactatga aaagatcctc 121 accagaaatc agatagagac ggtgctctca acaaggatcc agctagaaga agacataagc 181 aaaaaaatgg acaaagatga agaggctttg aaggcagctc aagcagaact caaggaggcc 241 cgacgccagt ggcaccacct gcaagtggaa attgaatctc tccatgctgt ggaaaggggc 301 cttgaaaact ccctacatgc cagcgagcag cattaccaga tgcagctgca agacctagag 361 actgtgattg aaggactaga aaaagagcta caggaagtaa ggcgcggcat cgaaaagcag 421 cttcaagagc acgagatgct tctcaacacg aagatgaggc tggaacaaga aatagcaact 481 tatcgccacc TCCTAGAAAA AGAAGAAATC AGATATTATG GTTGTATCCA AGGTGGGAAA 541 AAAGACAAAA AGCCTACCAC AAGTAGAGTT GGTTTTGTTT TACCATCAGC CATTATAAAT 601 GAAATATCTT TTACTACAAA AGTCCCACAA AAGTATGAGA ATGAAAATGT AGAAACAGTA 661 ACCAAACAGG CAATCTTAAA TGGGAGTATC GTTAAGGAGA GCACTGAAGC TCATGGCACT 721 ATTCAGACAG AGAAAGTGGA TGAAGTTATT AAAGAATGGG AAGGTTCTTT CTTTAAAGAT 781 AACCCTCGAT TGAGGAAAAA GTCTGTTTCT CTTCGATTTG ATCTTCATTT AGCAGCCACT 841 GATGAAGGGT GTTTAGAGAC TAAGCAGGAT AATCTACCAG ATATAGAAGT CAGGCTTATC 901 ATGAGAAGAT CATGCAGTAT TCCCTCTATC AAACCTCCAT CAACAGCTAA TTACCCAACT 961 TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT 1021 TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA 1081 TCTTGTGGAA AGGACGAGAA AGAACTGGCC GTGCGCACTA AACGCGTTAA GTCgacaatc 1141 aacctctgga ttacaaaatt tgtgaaagat t