Transcript: Mouse NM_172946.3

Mus musculus keratin 222 (Krt222), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-09-30
Taxon:
Mus musculus (mouse)
Gene:
Krt222 (268481)
Length:
3166
CDS:
110..994

Additional Resources:

NCBI RefSeq record:
NM_172946.3
NBCI Gene record:
Krt222 (268481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090200 GCTAGAGGAAGATATAACCAA pLKO.1 205 CDS 100% 3.000 4.200 N Krt222 n/a
2 TRCN0000090199 CCAGATATCGAAGTCAGACTT pLKO.1 917 CDS 100% 4.950 3.960 N Krt222 n/a
3 TRCN0000090201 GCCTGCTAGAACAGGAAGAAA pLKO.1 531 CDS 100% 5.625 3.938 N Krt222 n/a
4 TRCN0000090202 GATGCTTCTCAACACGAAGAT pLKO.1 478 CDS 100% 4.950 3.465 N Krt222 n/a
5 TRCN0000090198 GCGAGCTTTATCAGAGACTTT pLKO.1 1285 3UTR 100% 4.950 3.465 N Krt222 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1710 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04797 pDONR223 100% 85.8% 88.4% None (many diffs) n/a
2 ccsbBroad304_04797 pLX_304 0% 85.8% 88.4% V5 (many diffs) n/a
3 TRCN0000468793 GAAAGAACTGGCCGTGCGCACTAA pLX_317 52% 85.8% 88.4% V5 (many diffs) n/a
Download CSV