Construct: ORF TRCN0000468893
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002833.1_s317c1
- Derived from:
- ccsbBroadEn_04589
- DNA Barcode:
- TAGGTGACTCCGTGTGTTGGGCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DPH7 (92715)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468893
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_138778.5 | 100% | 100% | |
2 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346370.2 | 95.1% | 95.1% | 707_708ins66 |
3 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346371.2 | 72.4% | 69.9% | (many diffs) |
4 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346372.2 | 70.8% | 69.6% | (many diffs) |
5 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346373.2 | 70.3% | 65.1% | 0_1ins310;63_64ins92 |
6 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346374.2 | 66% | 64.8% | (many diffs) |
7 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346375.2 | 61% | 61% | 0_1ins528 |
8 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346376.2 | 61% | 61% | 0_1ins528 |
9 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346377.2 | 61% | 61% | 0_1ins528 |
10 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346378.2 | 61% | 61% | 0_1ins528 |
11 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346379.2 | 61% | 61% | 0_1ins528 |
12 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346380.2 | 61% | 61% | 0_1ins528 |
13 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346381.2 | 61% | 61% | 0_1ins528 |
14 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346382.2 | 61% | 61% | 0_1ins528 |
15 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346383.2 | 61% | 61% | 0_1ins528 |
16 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346384.2 | 61% | 61% | 0_1ins528 |
17 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346385.2 | 61% | 61% | 0_1ins528 |
18 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346386.2 | 61% | 61% | 0_1ins528 |
19 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346387.2 | 61% | 61% | 0_1ins528 |
20 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346388.2 | 61% | 61% | 0_1ins528 |
21 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346389.2 | 61% | 61% | 0_1ins528 |
22 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346390.2 | 61% | 61% | 0_1ins528 |
23 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346391.2 | 61% | 61% | 0_1ins528 |
24 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346392.2 | 61% | 61% | 0_1ins528 |
25 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346393.2 | 56.1% | 56.1% | 0_1ins528;179_180ins66 |
26 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346394.2 | 56.1% | 56.1% | 0_1ins528;179_180ins66 |
27 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346395.2 | 56.1% | 56.1% | 0_1ins528;179_180ins66 |
28 | human | 92715 | DPH7 | diphthamide biosynthesis 7 | NM_001346396.2 | 56.1% | 56.1% | 0_1ins528;179_180ins66 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1422
- ORF length:
- 1356
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gggctgtttc gccctgcaaa cggtggacac cgagctgacc gcggactcgg 121 tggagtggtg cccgctgcaa ggctgcaggc acctgctggc gtgcgggacc taccagctgc 181 ggcggccgga ggaccggcct gccggccccc agaacaaggg tggaatggaa gttaaggagc 241 ctcaggtccg tttaggccgt ctcttcctgt acagtttcaa tgacaacaac tctattcacc 301 ctctggtcga ggtccaaaga aaagatactt ctgcaatcct ggacatgaaa tggtgtcaca 361 tcccggtggc tggacatgcc ctcttgggct tggcagatgc cagtggatcc atacaactgc 421 tccgcctggt ggaatctgag aagagccacg tgctggagcc attgtccagc cttgccctgg 481 aggagcagtg tctggctttg tccctagatt ggtccactgg gaaaactgga agggccgggg 541 accagccctt gaagatcatc agcagtgact ccacagggca gctccacctc ctgatggtga 601 atgagacgag gcccaggctg cagaaagtgg cctcatggca ggcacatcaa ttcgaggcct 661 ggattgctgc tttcaattac tggcatccag aaattgtgta ttcagggggc gacgatggcc 721 ttctgagggg ctgggacacc agggtacccg gcaaatttct cttcaccagc aaaagacaca 781 ccatgggtgt gtgcagcatc cagagcagcc ctcatcggga gcacatcctg gccacgggaa 841 gctatgatga acacatccta ctgtgggaca cacgaaacat gaagcagccg ttggcagata 901 cgcctgtgca gggtggggta tggagaatca agtggcaccc tttccaccac cacctgctcc 961 tggccgccTG CATGCACAGT GGCTTTAAGA TCCTCAACTG CCAAAAGGCA ATGGAGGAGA 1021 GGCAGGAGGC GACGGTCCTG ACATCTCACA CATTGCCCGA CTCGCTGGTG TATGGAGCCG 1081 ACTGGTCCTG GCTGCTCTTC CGTTCTCTGC AGCGGGCCCC CTCGTGGTCC TTTCCTAGCA 1141 ACCTAGGAAC CAAGACGGCA GACCTGAAGG GTGCAAGCGA GTTGCCAACA CCCTGTCATG 1201 AATGCAGAGA GGATAACGAT GGGGAGGGCC ATGCCAGACC CCAGAGTGGA ATGAAGCCAC 1261 TCACAGAGGG CATGAGGAAG AATGGCACCT GGCTGCAGGC TACAGCAGCC ACCACACGTG 1321 ACTGTGGCGT GAACCCAGAA GAAGCAGACT CAGCCTTCAG CCTCCTGGCC ACCTGCTCCT 1381 TCTATGACCA TGCGCTCCAC CTCTGGGAGT GGGAGGGGAA CTGCCCAACT TTCTTGTACA 1441 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1501 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1561 AGGACGATAG GTGACTCCGT GTGTTGGGCA TACGCGTTAA GTCgacaatc aacctctgga 1621 ttacaaaatt tgtgaaagat t