Transcript: Human NM_001346385.2

Homo sapiens diphthamide biosynthesis 7 (DPH7), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DPH7 (92715)
Length:
2539
CDS:
914..1744

Additional Resources:

NCBI RefSeq record:
NM_001346385.2
NBCI Gene record:
DPH7 (92715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161855 GCTTTCAATTACTGGCATCCA pLKO.1 989 CDS 100% 2.640 3.696 N DPH7 n/a
2 TRCN0000162764 CATGCACAGTGGCTTTAAGAT pLKO.1 1291 CDS 100% 5.625 3.938 N DPH7 n/a
3 TRCN0000164312 CATCAATTCGAGGCCTGGATT pLKO.1 965 CDS 100% 4.950 3.465 N DPH7 n/a
4 TRCN0000416785 GAATCCACAGTGTAGTCAGAA pLKO_005 1863 3UTR 100% 4.950 3.465 N DPH7 n/a
5 TRCN0000433347 AGAAGCAGACTCAGCCTTCAG pLKO_005 1660 CDS 100% 4.050 2.835 N DPH7 n/a
6 TRCN0000424952 CCTGCTCCTTCTATGACCATG pLKO_005 1692 CDS 100% 4.050 2.835 N DPH7 n/a
7 TRCN0000160958 GAATGCAGAGAGGATAACGAT pLKO.1 1520 CDS 100% 3.000 2.100 N DPH7 n/a
8 TRCN0000161049 GCTGCTTTCAATTACTGGCAT pLKO.1 986 CDS 100% 2.640 1.848 N DPH7 n/a
9 TRCN0000415929 CATCAGAGATGCTTACTGCAG pLKO_005 1817 3UTR 100% 2.160 1.512 N DPH7 n/a
10 TRCN0000164311 CCTTTCCTAGCAACCTAGGAA pLKO.1 1449 CDS 100% 0.300 0.210 N DPH7 n/a
11 TRCN0000163464 GCCTGGATTGCTGCTTTCAAT pLKO.1 977 CDS 100% 5.625 3.375 N DPH7 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2262 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14342 pDONR223 100% 76.4% 68.9% None (many diffs) n/a
2 ccsbBroad304_14342 pLX_304 0% 76.4% 68.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000468082 CCTGTGTACGAATGTCTCTTCTAT pLX_317 56.5% 76.4% 68.9% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_04589 pDONR223 100% 61% 61% None 0_1ins528 n/a
5 ccsbBroad304_04589 pLX_304 0% 61% 61% V5 0_1ins528 n/a
6 TRCN0000468893 TAGGTGACTCCGTGTGTTGGGCAT pLX_317 33.7% 61% 61% V5 0_1ins528 n/a
Download CSV