Construct: ORF TRCN0000469118
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014490.1_s317c1
- Derived from:
- ccsbBroadEn_14248
- DNA Barcode:
- GTCAACGACAAATTAACCGTGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC23 (64927)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469118
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64927 | TTC23 | tetratricopeptide repeat do... | NM_001288615.3 | 85.9% | 84.9% | (many diffs) |
| 2 | human | 64927 | TTC23 | tetratricopeptide repeat do... | NM_001288616.3 | 85.9% | 84.9% | (many diffs) |
| 3 | human | 64927 | TTC23 | tetratricopeptide repeat do... | NM_001353869.2 | 85.9% | 84.9% | (many diffs) |
| 4 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022512.1 | 85.9% | 84.9% | (many diffs) |
| 5 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022513.2 | 85.9% | 84.9% | (many diffs) |
| 6 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022514.1 | 85.9% | 84.9% | (many diffs) |
| 7 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022515.1 | 85.9% | 84.9% | (many diffs) |
| 8 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022516.2 | 85.9% | 84.9% | (many diffs) |
| 9 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022518.1 | 85.9% | 84.9% | (many diffs) |
| 10 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_024450029.1 | 85.9% | 84.9% | (many diffs) |
| 11 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521944.2 | 85.2% | 82.8% | (many diffs) |
| 12 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521943.2 | 84.5% | 82.1% | (many diffs) |
| 13 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521941.2 | 79.1% | 77.6% | (many diffs) |
| 14 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521940.2 | 78.6% | 75.9% | (many diffs) |
| 15 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521929.1 | 74.4% | 71.9% | (many diffs) |
| 16 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521930.1 | 74.4% | 71.9% | (many diffs) |
| 17 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521931.1 | 74.4% | 71.9% | (many diffs) |
| 18 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521932.2 | 74.4% | 71.9% | (many diffs) |
| 19 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521933.1 | 74.4% | 71.9% | (many diffs) |
| 20 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521934.2 | 74.4% | 71.9% | (many diffs) |
| 21 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521935.1 | 74.4% | 71.9% | (many diffs) |
| 22 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521936.1 | 74.4% | 71.9% | (many diffs) |
| 23 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521937.1 | 74.4% | 71.9% | (many diffs) |
| 24 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521939.1 | 74.4% | 71.9% | (many diffs) |
| 25 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022509.2 | 74.4% | 71.9% | (many diffs) |
| 26 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022510.1 | 74.4% | 71.9% | (many diffs) |
| 27 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_017022511.2 | 74.4% | 71.9% | (many diffs) |
| 28 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_024450027.1 | 74.4% | 71.9% | (many diffs) |
| 29 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_024450028.1 | 74.4% | 71.9% | (many diffs) |
| 30 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XM_011521927.2 | 74.2% | 72.2% | (many diffs) |
| 31 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_931893.2 | 59.5% | (many diffs) | |
| 32 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_931890.2 | 56% | (many diffs) | |
| 33 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_931895.2 | 37.5% | (many diffs) | |
| 34 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_002957671.1 | 35.4% | (many diffs) | |
| 35 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_931888.2 | 35.2% | (many diffs) | |
| 36 | human | 64927 | TTC23 | tetratricopeptide repeat do... | NR_109947.3 | 32.6% | (many diffs) | |
| 37 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_002957673.1 | 31.5% | (many diffs) | |
| 38 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_002957670.1 | 30.4% | (many diffs) | |
| 39 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_001751378.1 | 30.2% | (many diffs) | |
| 40 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_002957672.1 | 30.2% | (many diffs) | |
| 41 | human | 64927 | TTC23 | tetratricopeptide repeat do... | XR_001751379.2 | 26% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1245
- ORF length:
- 1179
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca anaatcacag gaaacccaca tatccaacca cctagatgaa gttgttgctg 121 ctgttagcat cactcataga aagaagttcc aaaacaagct gcttcagaca gcactattcc 181 agcctcctcg agagaaactc cacctctgtg aagagaaagc aaagtcctat tccaacagtc 241 atgagtacaa acaggccgtc catgagcttg tgcgttgcgt agcactgaca agaatttgct 301 atggagactc acattggaaa ctagcagagg cacatgttaa tctggctcaa ggctacctcc 361 agctgaaagg actgtcactg caagcaaaac aacatgcaga aaaagccaga caaatcctcg 421 ccaactccat tgtgcctccc tatagtgaga atacagatgt tttcaagttt tccattgagc 481 ttttccatac catgggcaga gctttactct cccttcaaaa atttaaggaa gctgcagaga 541 atttgacaaa agcagagaga ctttcaaagg agctgctaca atgtggaaga attataaagg 601 aagaatggat agaaattgaa gcacggatca gattatcatt tgcacaggtg tatcaaggtc 661 agaagaagtc aaaagaagct ttgtcccact atcaagcagc tttggaatat gttgagatca 721 gtaaaggtga aacaagtcgt gagtgtgtac ccatattgag agaattagca ggtgtagagc 781 aagccctggg actccacgat gtatccatca accacttcct ccaggcacat ctcatcatcc 841 TGAGTAGAAG CCCCTCTCAA GTGGAGGCAG CAGACTCGGC ACACATCGTC GCCCATGCTG 901 CTGTCGCTTC AGGGAGACAC GAGCACCATG ATGTAGCTGA GCAGTATTTT CAAGAGAGCA 961 TGGCTCATCT TAAGGATTCT GAAGGGATGG GAAGAACCAA ATTTCTTTCA ATTCAAGATG 1021 AATTTTGCCA TTTTCTACAA ATGACTGGAC AAAAAGAGAG AGCAACCTCG ATCCTGAGAG 1081 AGTCCCTGGA AGCCAAAGTG GAAGCATTTG GCGATTTCAG TCCCGAGGTG GCAGAGACAT 1141 ACCGGCTCCT GGGAGGAGCA GACCTGGCGC AGGGGAACCA CAGTGGGGCC CGCAAGAAAC 1201 TGAAGAAGGG AGACCTTAGT TTCCTGCTCT CAGCGACACT TCCATACCCA ACTTTCTTGT 1261 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1321 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1381 GAAAGGACGA GTCAACGACA AATTAACCGT GTCAACGCGT TAAGTCgaca atcaacctct 1441 ggattacaaa atttgtgaaa gatt