Transcript: Human XM_017022511.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 23 (TTC23), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC23 (64927)
Length:
3731
CDS:
475..2058

Additional Resources:

NCBI RefSeq record:
XM_017022511.2
NBCI Gene record:
TTC23 (64927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433083 GCACGGATCAGATTATCATTT pLKO_005 1030 CDS 100% 13.200 18.480 N TTC23 n/a
2 TRCN0000005127 GTACCCATATTGAGAGAATTA pLKO.1 1156 CDS 100% 0.000 0.000 N TTC23 n/a
3 TRCN0000005124 CCTTTCTTATAGGAGGCTAAT pLKO.1 2443 3UTR 100% 10.800 8.640 N TTC23 n/a
4 TRCN0000434880 CAGATCCAGACCCTCTTATAT pLKO_005 1850 CDS 100% 15.000 10.500 N TTC23 n/a
5 TRCN0000005128 GCGTAGCACTGACAAGAATTT pLKO.1 686 CDS 100% 13.200 9.240 N TTC23 n/a
6 TRCN0000428180 TGAGATCAGTAAAGGTGAAAC pLKO_005 1122 CDS 100% 10.800 7.560 N TTC23 n/a
7 TRCN0000005125 GCTGCTACAATGTGGAAGAAT pLKO.1 981 CDS 100% 5.625 3.938 N TTC23 n/a
8 TRCN0000005126 GCTGCTGTTAGCATCACTCAT pLKO.1 526 CDS 100% 4.950 3.465 N TTC23 n/a
9 TRCN0000430142 AGAGAAAGCAAAGTCCTATTC pLKO_005 621 CDS 100% 10.800 6.480 N TTC23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14248 pDONR223 100% 74.4% 71.9% None (many diffs) n/a
2 ccsbBroad304_14248 pLX_304 0% 74.4% 71.9% V5 (many diffs) n/a
3 TRCN0000469118 GTCAACGACAAATTAACCGTGTCA pLX_317 34.6% 74.4% 71.9% V5 (many diffs) n/a
Download CSV