Construct: ORF TRCN0000469178
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007903.1_s317c1
- Derived from:
- ccsbBroadEn_11917
- DNA Barcode:
- CCATAGGATGCTTCTATGACCCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PILRA (29992)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469178
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 29992 | PILRA | paired immunoglobin like ty... | NM_178272.2 | 90.7% | 83.1% | (many diffs) |
| 2 | human | 29992 | PILRA | paired immunoglobin like ty... | NM_178273.2 | 77.1% | 64.8% | (many diffs) |
| 3 | human | 29990 | PILRB | paired immunoglobin like ty... | NM_178238.3 | 72.5% | 64.7% | (many diffs) |
| 4 | human | 29992 | PILRA | paired immunoglobin like ty... | NM_013439.3 | 69.5% | 63.6% | (many diffs) |
| 5 | human | 29992 | PILRA | paired immunoglobin like ty... | XM_024446739.1 | 69.5% | 63.6% | (many diffs) |
| 6 | human | 29990 | PILRB | paired immunoglobin like ty... | NM_001371931.1 | 66.2% | 52.2% | (many diffs) |
| 7 | human | 101752399 | STAG3L5P-PVRIG2P-PILRB | STAG3L5P-PVRIG2P-PILRB read... | NR_036569.1 | 16.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 744
- ORF length:
- 678
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tcggcccctg ctgctgcccc tactgcccct gctgctgccg ccagcatttc 121 tgcagcctag tggctccaca ggatctggtc caagctacct ttatggggtc actcaaccaa 181 aacacctctc agcctccatg ggtggctctg tggaaatccc cttctccttc tattacccct 241 gggagttagc cacagctccc gacgtgagaa tatcctggag acggggccac ttccacgggc 301 agtccttcta cagcacaagg ccgccttcca ttcacaagga ttatgtgaac cggctctttc 361 tgaactggac agagggtcag aagagcggct tcctcaggat ctccaaccTG CAGAAGCAGG 421 ACCAGTCTGT GTATTTCTGC CGAGTTGAGC TGGACACACG GAGCTCAGGG AGGCAGCAGT 481 GGCAGTCCAT CGAGGGGACC AAACTCTCCA TCACCCAGGG TCAGCAGCGG ACTAAAGCCA 541 CAACCCCAGC CAGGGAACCC TTCCAAAACA CAGAGGAGCC ATATGAGAAT ATCAGGAATG 601 AAGGACAAAA TACAGATCCC AAGCTAAATC CCAAGCTCCA CCTCACCCAG AGCACCTCCC 661 AGCCACCGTC CCCTCAAGAG CCCCCAGAAC GAGACCCTGT ACTCTGTCTT AAAGGCCTAA 721 CCAATGGACA GCCCTCTCAA GACTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 781 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 841 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC CATAGGATGC 901 TTCTATGACC CATACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 961 att