Transcript: Human NM_001371931.1

Homo sapiens paired immunoglobin like type 2 receptor beta (PILRB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PILRB (29990)
Length:
1609
CDS:
301..1155

Additional Resources:

NCBI RefSeq record:
NM_001371931.1
NBCI Gene record:
PILRB (29990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296906 GCATCCACACTGCAATGATAT pLKO_005 1366 3UTR 100% 13.200 6.600 Y PILRB n/a
2 TRCN0000060993 ACTCAGAATCATGGCACCTAA pLKO.1 833 CDS 100% 4.950 2.475 Y PILRB n/a
3 TRCN0000060997 CACTGCCATCAGGGTTGCATT pLKO.1 861 CDS 100% 4.950 2.475 Y PILRB n/a
4 TRCN0000060995 CCATAGTTCCCAACGTGAGAA pLKO.1 485 CDS 100% 4.950 2.475 Y PILRB n/a
5 TRCN0000291329 CCATAGTTCCCAACGTGAGAA pLKO_005 485 CDS 100% 4.950 2.475 Y PILRB n/a
6 TRCN0000060994 CGCCTTCCATTCACAAGGATT pLKO.1 557 CDS 100% 4.950 2.475 Y PILRB n/a
7 TRCN0000291328 CGCCTTCCATTCACAAGGATT pLKO_005 557 CDS 100% 4.950 2.475 Y PILRB n/a
8 TRCN0000060996 CGGCTTCCTCAGGATCTCAAA pLKO.1 621 CDS 100% 4.950 2.475 Y PILRB n/a
9 TRCN0000291327 CGGCTTCCTCAGGATCTCAAA pLKO_005 621 CDS 100% 4.950 2.475 Y PILRB n/a
10 TRCN0000331166 GCAGCAGTTGCAGTCCATCAA pLKO_005 708 CDS 100% 4.950 2.475 Y PILRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03124 pDONR223 100% 79.9% 79.9% None 656_826del n/a
2 ccsbBroad304_03124 pLX_304 0% 79.9% 79.9% V5 656_826del n/a
3 TRCN0000469374 ATCCCAATCCGCCCCATCTCATAC pLX_317 64% 79.9% 79.9% V5 656_826del n/a
4 ccsbBroadEn_11917 pDONR223 100% 66.2% 52.2% None (many diffs) n/a
5 ccsbBroad304_11917 pLX_304 0% 66.2% 52.2% V5 (many diffs) n/a
6 TRCN0000469178 CCATAGGATGCTTCTATGACCCAT pLX_317 49.5% 66.2% 52.2% V5 (many diffs) n/a
Download CSV