Construct: ORF TRCN0000469264
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006343.1_s317c1
- Derived from:
- ccsbBroadEn_14939
- DNA Barcode:
- TACAGCTGCCGTGACGTCAGAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNK6 (9424)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469264
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9424 | KCNK6 | potassium two pore domain c... | NM_004823.3 | 100% | 100% | |
| 2 | human | 9424 | KCNK6 | potassium two pore domain c... | XM_024451788.1 | 57.1% | 57.1% | 0_1ins402 |
| 3 | human | 9424 | KCNK6 | potassium two pore domain c... | XM_017027506.1 | 48.1% | 34.2% | (many diffs) |
| 4 | human | 9424 | KCNK6 | potassium two pore domain c... | XM_011527527.1 | 47.6% | 34.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1005
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg gaggggcgcg cttctggcgg gcgccttggc cgcgtacgcc gcgtacctgg 121 tgctgggcgc gctgttggtg gcgcggctgg aggggccgca cgaagccagg ctccgagccg 181 agctggagac gctgcgggcg cagctgcttc agcgcagccc gtgtgtggct gcccccgccc 241 tggacgcctt cgtggagcga gtgctggcgg ccggacggct ggggcgggtc gtgcttgcta 301 acgcttcggg gtccgccaac gcctcggacc ccgcctggga cttcgcctct gctctcttct 361 tcgccagcac gctgatcacc accgtgggct atgggtacac aacgccactg actgatgcgg 421 gcaaggcctt ctccatcgcc tttgcgctcc tgggcgtgcc gaccaccatg ctgctgctga 481 ccgcctcagc ccagcgcctg tcactgctgc tgactcacgt gcccctgtct tggctgagca 541 tgcgttgggg ctgggacccc cggcgggcgg cctgctggca cttggtggcc ctgttggggg 601 tcgtagtgac cgtctgcttt ctggtgccgg ctgtgatctt tgcccacctc gaggaggcct 661 ggagcttctt ggatgccTTC TACTTCTGCT TTATCTCTCT GTCCACCATC GGCCTGGGCG 721 ACTACGTGCC CGGGGAGGCC CCTGGCCAGC CCTACCGGGC CCTCTACAAG GTGCTGGTCA 781 CAGTCTACCT CTTCCTGGGC CTGGTGGCCA TGGTGCTGGT GCTGCAGACC TTCCGCCACG 841 TGTCCGACCT CCACGGCCTC ACGGAGCTCA TCCTGCTGCC CCCTCCGTGC CCTGCCAGTT 901 TCAATGCGGA TGAGGACGAT CGGGTGGACA TCCTGGGCCC CCAGCCGGAG TCGCACCAGC 961 AACTCTCTGC CAGCTCCCAC ACCGACTACG CTTCCATCCC CAGGTACCCA ACTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA TACAGCTGCC GTGACGTCAG AATCACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt