Transcript: Human XM_024451788.1

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 6 (KCNK6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK6 (9424)
Length:
3512
CDS:
1824..2363

Additional Resources:

NCBI RefSeq record:
XM_024451788.1
NBCI Gene record:
KCNK6 (9424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434841 GTCGTAGTGACCGTCTGCTTT pLKO_005 1956 CDS 100% 4.950 6.930 N KCNK6 n/a
2 TRCN0000045025 CCACACCGACTACGCTTCCAT pLKO.1 2333 CDS 100% 1.000 1.400 N KCNK6 n/a
3 TRCN0000045024 CCTGCCAGTTTCAATGCGGAT pLKO.1 2247 CDS 100% 2.160 1.512 N KCNK6 n/a
4 TRCN0000045026 GCTTTATCTCTCTGTCCACCA pLKO.1 2044 CDS 100% 2.160 1.512 N KCNK6 n/a
5 TRCN0000045027 CTTCTTGGATGCCTTCTACTT pLKO.1 2021 CDS 100% 4.950 2.970 N KCNK6 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1538 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1538 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14939 pDONR223 97.4% 57.1% 57.1% None 0_1ins402 n/a
2 ccsbBroad304_14939 pLX_304 0% 57.1% 57.1% V5 0_1ins402 n/a
3 TRCN0000469264 TACAGCTGCCGTGACGTCAGAATC pLX_317 35.2% 57.1% 57.1% V5 0_1ins402 n/a
Download CSV