Construct: ORF TRCN0000469302
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009540.1_s317c1
- Derived from:
- ccsbBroadEn_04913
- DNA Barcode:
- ATGGTCGTTTTGATCCGAAGGCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCAF4L2 (138009)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469302
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 138009 | DCAF4L2 | DDB1 and CUL4 associated fa... | NM_152418.4 | 100% | 100% | |
| 2 | human | 26094 | DCAF4 | DDB1 and CUL4 associated fa... | XM_017021215.2 | 60% | 54.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1254
- ORF length:
- 1185
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagagcaaa agaccgcgac tgctcgagga agcagacaag cagaaaaaga 121 cagtcagagt gggactcaat gcaccttcca tgctacgaaa gaaccagcta ggtttcctca 181 gattcgccaa ctattgccgt atagctcgcg agctgcgtgt aagctgcatg cagaggaaaa 241 aggtccagat tcatagctgg gatccctcct ctttggcaag cgaccgattt aaccgcatac 301 tggcgaatac caacactgac cagctcttca cagtgaacca agtcgaagct ggaggctcca 361 agtacggcat catcaccatg cgaggcctga cgacccctga gctccgggta tacccgcaca 421 aaaccctcta cgtccctaat cggaaggtga attctatgtg ctgggcctca ctgaatcact 481 tggattccca ccttctgctg tgcttcgtgg gacttgcaga tactccaagc tgtgccgtgc 541 tgctcccagc gtcgctgttc ataggtagct tcccaggaat gcgtcggcct ggcatgcttt 601 gcagtttcca gatccctgat gcctggtcct gtgcctggtc cctgagcatc cacgcgtatc 661 actctttcag tacaggcttg tctcagcagg tcctgttgac caacgtggtg acgggacacc 721 agcagtcatt tgggactagc agtgatgtct tggcccagca gtttgcaatc atgactcctt 781 tgctgtttaa tggctgtcgc tctggggaga tctttggcat tgatctgcgc tgtggaaatc 841 aaggcagcgg gtggaaggcc atttgcctgt cccatgattc agcagtgact tctctgcaaa 901 tcctccaaga tggccaattc ctggtgtcat cagacatgac tggaactatc aagctgtggg 961 acttgagggc cactaaatgt gtaacacagt acgaaggtca tgtgaataac tccgcctacc 1021 tacccgtgca tgtgaacgaa gaagaaggag tcgtggcggc cgtgggccag gactgctaca 1081 cgaGAATCTG GAGCCTCCGT CATGGCCACC TGCTCACAAC CATACCCTCC CCATACCCCG 1141 CCTCGGAGAA CGACATTCCC AGTGTGGCCT TCTCTTCTCG CCTCGGGGGC TTCCGAGGAG 1201 CACCAGGGCT GCTCATGGCT GTCCGGGAGG ACCTTTATTG TTTCTCCTAC GGTTTGCCAA 1261 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1321 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1381 TATCTTGTGG AAAGGACGAA TGGTCGTTTT GATCCGAAGG CTCACGCGTT AAGTCgacaa 1441 tcaacctctg gattacaaaa tttgtgaaag att