Transcript: Human NM_152418.4

Homo sapiens DDB1 and CUL4 associated factor 4 like 2 (DCAF4L2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DCAF4L2 (138009)
Length:
3269
CDS:
45..1232

Additional Resources:

NCBI RefSeq record:
NM_152418.4
NBCI Gene record:
DCAF4L2 (138009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422941 TAACCGCATACTGGCGAATAC pLKO_005 266 CDS 100% 10.800 15.120 N DCAF4L2 n/a
2 TRCN0000423867 TTGTTTCTCCTACGGTTAATT pLKO_005 1214 CDS 100% 15.000 12.000 N DCAF4L2 n/a
3 TRCN0000152035 CCTGACTATGAGAAGTAGAAA pLKO.1 2595 3UTR 100% 5.625 4.500 N DCAF4L2 n/a
4 TRCN0000150660 GCATCGTATTACCGTTTCTAT pLKO.1 1285 3UTR 100% 5.625 3.938 N DCAF4L2 n/a
5 TRCN0000156920 GTCCCTAATCGGAAGGTGAAT pLKO.1 408 CDS 100% 4.950 3.465 N DCAF4L2 n/a
6 TRCN0000152958 GTGCATGTGAACGAAGAAGAA pLKO.1 1002 CDS 100% 4.950 3.465 N DCAF4L2 n/a
7 TRCN0000151081 GTTTGCAATCATGACTCCTTT pLKO.1 737 CDS 100% 4.950 3.465 N DCAF4L2 n/a
8 TRCN0000152511 GTAACACAGTACGAAGGTCAT pLKO.1 957 CDS 100% 4.050 2.835 N DCAF4L2 n/a
9 TRCN0000156812 GTCCAGATTCATAGCTGGGAT pLKO.1 219 CDS 100% 2.640 1.848 N DCAF4L2 n/a
10 TRCN0000150343 CTTTATTGTTTCTCCTACGGT pLKO.1 1209 CDS 100% 0.750 0.525 N DCAF4L2 n/a
11 TRCN0000419081 GAACGTGGATTTGACTTAAAG pLKO_005 1255 3UTR 100% 13.200 7.920 N DCAF4L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04913 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04913 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469302 ATGGTCGTTTTGATCCGAAGGCTC pLX_317 14.9% 100% 100% V5 n/a
Download CSV