Construct: ORF TRCN0000469351
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012306.1_s317c1
- Derived from:
- ccsbBroadEn_02316
- DNA Barcode:
- CTTCGTCCACTGCTTACGCTCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CTDSP2 (10106)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469351
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10106 | CTDSP2 | CTD small phosphatase 2 | NM_005730.4 | 100% | 100% | |
2 | human | 10106 | CTDSP2 | CTD small phosphatase 2 | XM_005268556.2 | 97.8% | 97.8% | 252_269del |
3 | mouse | 52468 | Ctdsp2 | CTD (carboxy-terminal domai... | NM_001113470.1 | 89.9% | 94.4% | (many diffs) |
4 | mouse | 52468 | Ctdsp2 | CTD (carboxy-terminal domai... | XM_017314028.1 | 82% | 86.1% | (many diffs) |
5 | mouse | 52468 | Ctdsp2 | CTD (carboxy-terminal domai... | NM_146012.2 | 39.7% | 42% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 879
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga acacggctcc atcatcaccc aggcgcggag ggaagacgcc ctggtgctca 121 ccaagcaagg cctggtctcc aagtcctctc ctaagaagcc tcgtggacgt aacatcttca 181 aggccctttt ctgctgtttt cgcgcccagc atgttggcca gtcaagttcc tccactgagc 241 tcgctgcgta taaggaggaa gcaaacacca ttgctaagtc ggatctgctc cagtgtctcc 301 agtaccagtt ctaccagatc ccagggacct gcctgctccc agaggtgaca gaggaagatc 361 aaggaaggat ctgtgtggtc attgacctcg atgaaaccct tgtgcatagc tcctttaagc 421 caatcaacaa tgctgacttc atagtgccta tagagattga ggggaccact caccaggtgt 481 atgtgctcaa gaggccttat gtggatgagt tcctgagacg catgggggaa ctctttgaat 541 gtgttctctt cactgccagc ctggccaagt atgccgaccc tgtgacagac ctgctggacc 601 ggtgtggggt gttccgggcc cgcctattcc gtgagtcttg cgtgttccac cagggctgct 661 acgtcaagga ccTCAGCCGC CTGGGGAGGG ACCTGAGAAA GACCCTCATC CTGGACAACT 721 CGCCTGCTTC TTACATATTC CACCCCGAGA ATGCAGTGCC TGTGCAGTCC TGGTTTGATG 781 ACATGGCAGA CACTGAGTTG CTGAACCTGA TCCCAATCTT TGAGGAGCTG AGCGGAGCAG 841 AGGACGTCTA CACCAGCCTT GGGCAGCTGC GGGCCCCTTA CCCAACTTTC TTGTACAAAG 901 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 961 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1021 ACGACTTCGT CCACTGCTTA CGCTCTCTAC GCGTTAAGTC gacaatcaac ctctggatta 1081 caaaatttgt gaaagatt