Transcript: Human NM_005730.4

Homo sapiens CTD small phosphatase 2 (CTDSP2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CTDSP2 (10106)
Length:
4785
CDS:
295..1110

Additional Resources:

NCBI RefSeq record:
NM_005730.4
NBCI Gene record:
CTDSP2 (10106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005730.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367453 GCCTCGTGGACGTAACATCTT pLKO_005 387 CDS 100% 4.950 6.930 N CTDSP2 n/a
2 TRCN0000220114 GTGTCTCCAGTACCAGTTCTA pLKO.1 522 CDS 100% 4.950 6.930 N CTDSP2 n/a
3 TRCN0000220113 CTAAGAAGCCTCGTGGACGTA pLKO.1 380 CDS 100% 2.640 3.696 N CTDSP2 n/a
4 TRCN0000367406 ACTGAGCTCGCTGCGTATAAG pLKO_005 463 CDS 100% 13.200 9.240 N CTDSP2 n/a
5 TRCN0000367493 AGTAACTGGAAAGAGCTTTAG pLKO_005 1231 3UTR 100% 10.800 7.560 N CTDSP2 n/a
6 TRCN0000367394 GCTGACTTCATAGTGCCTATA pLKO_005 661 CDS 100% 10.800 7.560 N CTDSP2 n/a
7 TRCN0000367472 GTGTAGGGATGAAGACTATTG pLKO_005 1482 3UTR 100% 10.800 7.560 N CTDSP2 n/a
8 TRCN0000220112 GAGGCAGGTATCACAAAGCAT pLKO.1 2650 3UTR 100% 3.000 2.100 N CTDSP2 n/a
9 TRCN0000010657 GCTCCAGTGTCTCCAGTACCA pLKO.1 516 CDS 100% 0.880 0.616 N CTDSP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005730.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02316 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02316 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469351 CTTCGTCCACTGCTTACGCTCTCT pLX_317 26% 100% 100% V5 n/a
Download CSV