Construct: ORF TRCN0000469359

Construct Description:

Construct Type:
ORF
Other Identifiers:
ORF016415.1_s317c1
Derived from:
ccsbBroadEn_15974
DNA Barcode:
CAACTGTCTGTAAAGCGAATCGCG
Epitope Tag:
V5
Notes:
No stop codon in insert

Originally Annotated References:

Gene:
IQCH (64799)

Vector Information:

Vector Backbone:
pLX_317
Pol II Cassette 1:
SV40-PuroR
Pol II Cassette 2:
EF1a-TRCN0000469359
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
n/a

Current transcripts matched by this ORF:

Taxon Gene Symbol Description Transcript Nuc. Match %[?] Prot. Match %[?] Match Diffs[?]
1 human 64799 IQCH IQ motif containing H NM_001284349.1 74% 74% 1_237del
2 human 64799 IQCH IQ motif containing H NM_001322472.2 38% 36.6% (many diffs)
3 human 64799 IQCH IQ motif containing H NM_001322471.2 37.6% 36.1% (many diffs)
4 human 64799 IQCH IQ motif containing H NM_001284348.2 35.4% 34.1% (many diffs)
5 human 64799 IQCH IQ motif containing H NM_001322473.2 33.6% 32.3% (many diffs)
6 human 64799 IQCH IQ motif containing H NM_001322474.2 33.5% 32.2% (many diffs)
7 human 64799 IQCH IQ motif containing H NM_001284347.2 32.2% 30.9% (many diffs)
8 human 64799 IQCH IQ motif containing H NM_001322470.2 30.5% 29.3% (many diffs)
9 human 64799 IQCH IQ motif containing H NM_001322475.2 28.8% 27.7% (many diffs)
10 human 64799 IQCH IQ motif containing H NM_001031715.3 21.4% 20.6% (many diffs)
11 human 64799 IQCH IQ motif containing H NR_147832.2 17.8% (many diffs)
Download CSV

Sequence Information

Note: uppercase bases indicate empirically verified sequence.

ORF start:
66
ORF end:
744
ORF length:
678
Sequence:
1tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag
61ttggcatgaa agtcaaaaca cctttgagag ccctgaaatc actgtgggat tatgactttt
121taatttatga tggtgtcata gacaatacag ccccagactt cttagcattc aaggaacatt
181ttagcttagc ttggggaggt attttttctc tcttggaaca cgtcgagaag tttctcagga
241actatgctat accagaagtc aaaataaaag ggaataattt ggtggccctc cttccagagt
301ttgagctgac gaataaactt accagatatg accTTCTCTC AGTGTTAGAG GACCCAGCTC
361ATGTCCAAAT GCTGATAAAT CTTCCAGGGC AAAGGTACAA GGGCCAAGAT GGAAATTCGG
421AGGCCGCCAT GAAGATCCAA GCCACATGGA AATGCTACAA AGCAAGAAAA TTCTTCCTCT
481TTTATCGCCA GCAGAAGTGG GCATCAGGTG TGATTGCCAT TGCTTGGCTG TTATATTGCC
541ATAAGACTCG ACTAAAGAAG ATACTAAAGG AATCACGTCA GAGACACCTG GAGAATTTTC
601GCATTCGAGC CAAGCATCTG GCAGCCAACT GGAATCGCAT CAGGACCTCC AGGAGGACTA
661TTATCCATAT CCCATCATTA GGTATAACAC TTTTGCCTGC AAATCTATCA GCAACCTCTA
721TTACCCACCA CATTATGGCT CCTTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA
781AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC
841TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC AACTGTCTGT
901AAAGCGAATC GCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag
961att

Download FASTA (ORF) (Full)