Construct: ORF TRCN0000469411
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008470.1_s317c1
- Derived from:
- ccsbBroadEn_01397
- DNA Barcode:
- GCGGCAAAGTAAGGATGCCTCCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RGS13 (6003)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469411
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6003 | RGS13 | regulator of G protein sign... | NM_002927.5 | 100% | 100% | |
| 2 | human | 6003 | RGS13 | regulator of G protein sign... | NM_144766.3 | 100% | 100% | |
| 3 | mouse | 246709 | Rgs13 | regulator of G-protein sign... | NM_153171.4 | 84.9% | 83% | (many diffs) |
| 4 | mouse | 246709 | Rgs13 | regulator of G-protein sign... | XM_006529613.2 | 84.9% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 543
- ORF length:
- 477
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag caggcggaat tgttggattt gtaagatgtg cagagatgaa tctaagaggc 121 ccccttcaaa ccttactttg gaggaagtat tacagtgggc ccagtctttt gaaaatttaa 181 tggctacaaa atatggtcca gtagtctatg cagcatattt aaaaatggag cacagtgacg 241 agaatattca attctggatg gcatgtgaaa cctataagaa aattgcctca cggtggagca 301 gaatttctag ggcaaagaag ctttataaga tttaCATCCA GCCACAGTCC CCTAGAGAGA 361 TTAACATTGA CAGTTCGACA AGAGAGACTA TCATCAGGAA CATTCAGGAA CCCACTGAAA 421 CATGTTTTGA AGAAGCTCAG AAAATAGTCT ATATGCATAT GGAAAGGGAT TCCTACCCCA 481 GATTTCTAAA GTCAGAAATG TACCAAAAAC TTTTGAAAAC TATGCAGTCC AACAACAGTT 541 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 601 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 661 GGCTTTATAT ATCTTGTGGA AAGGACGAGC GGCAAAGTAA GGATGCCTCC GTACGCGTTA 721 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt