Transcript: Mouse NM_153171.4

Mus musculus regulator of G-protein signaling 13 (Rgs13), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rgs13 (246709)
Length:
1497
CDS:
187..663

Additional Resources:

NCBI RefSeq record:
NM_153171.4
NBCI Gene record:
Rgs13 (246709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037233 GCTATGCAGAGATGAATCTAA pLKO.1 216 CDS 100% 5.625 4.500 N Rgs13 n/a
2 TRCN0000037229 GCACATGGAAATGGATTCTTA pLKO.1 576 CDS 100% 5.625 3.938 N Rgs13 n/a
3 TRCN0000037231 GCTCCCTTCAAACCTTACTTT pLKO.1 240 CDS 100% 5.625 3.938 N Rgs13 n/a
4 TRCN0000037230 GCATTCGTGAACCCACTCAAA pLKO.1 521 CDS 100% 4.950 3.465 N Rgs13 n/a
5 TRCN0000037232 CCCACTCAAACATGCTTTGAA pLKO.1 532 CDS 100% 0.563 0.394 N Rgs13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01397 pDONR223 100% 84.9% 83% None (many diffs) n/a
2 ccsbBroad304_01397 pLX_304 0% 84.9% 83% V5 (many diffs) n/a
3 TRCN0000469411 GCGGCAAAGTAAGGATGCCTCCGT pLX_317 44% 84.9% 83% V5 (many diffs) n/a
4 TRCN0000489882 GTACGTAGGCTGAATTCCAACGCG pLX_317 74.1% 84.9% 83% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV