Construct: ORF TRCN0000469423
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002513.1_s317c1
- Derived from:
- ccsbBroadEn_11062
- DNA Barcode:
- GGACTTCGACTGTAAGCTACCGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRSS3 (5646)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469423
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5644 | PRSS1 | serine protease 1 | NM_002769.5 | 97.5% | 95.1% | (many diffs) |
| 2 | human | 5646 | PRSS3 | serine protease 3 | NM_002771.3 | 93.7% | 91.4% | (many diffs) |
| 3 | human | 5645 | PRSS2 | serine protease 2 | NM_002770.4 | 91.9% | 86.6% | (many diffs) |
| 4 | human | 5646 | PRSS3 | serine protease 3 | NM_001197098.1 | 89% | 86.3% | (many diffs) |
| 5 | human | 5645 | PRSS2 | serine protease 2 | NM_001303414.1 | 86.9% | 81.9% | (many diffs) |
| 6 | human | 5646 | PRSS3 | serine protease 3 | NM_001197097.2 | 85.5% | 81.9% | (many diffs) |
| 7 | human | 154754 | PRSS3P2 | PRSS3 pseudogene 2 | NR_001296.3 | 79.4% | (many diffs) | |
| 8 | human | 5645 | PRSS2 | serine protease 2 | NR_130149.2 | 75.6% | (many diffs) | |
| 9 | human | 5646 | PRSS3 | serine protease 3 | NM_007343.3 | 74.1% | 71.3% | (many diffs) |
| 10 | human | 5646 | PRSS3 | serine protease 3 | XM_011517965.1 | 66.9% | 62.4% | (many diffs) |
| 11 | human | 5644 | PRSS1 | serine protease 1 | XM_011516411.1 | 51% | 49.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 810
- ORF length:
- 741
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatccattc ctgatccttg cctttgtggg agctgctgtt gctgtcccct 121 ttgacgatga tgacaagatt gttgggggct acacctgtga ggagaattct ctcccctacc 181 aggtgtccct gaattctggc tcccacttct gcggtggctc cctcatcagc gaacagtggg 241 tggtatcagc agctcactgc tacaagaccc gcatccaggt gagactggga gagcacaaca 301 tcaaagtcct ggaggggaat gagcagttca tcaatgcagc caagatcatc cgccaccccc 361 aatacgacag gaagactctg aacaatgaca tcatgttaat caagctctcc tcacgtgcag 421 taatcaacgc ccgcgtgtcc accatctctc tgcccaccgc ccctccagcc actggcacga 481 agtgcctcat ctctggctgg ggcaacactg cgagctctgg cgccgactac ccagacgagc 541 tgcagtgcct ggacgctcct gtgcTGAGCC AGGCTAAGTG TGAAGCCTCC TACCCTGGAA 601 AGATTACCAG CAACATGTTC TGTGTGGGCT TCCTTGAGGG AGGCAAGGAT TCATGTCAGG 661 GTGATTCTGG TGGCCCTGTG GTCTGCAATG GACAGCTCCA AGGAGTTGTC TCCTGGGGTG 721 ATGGCTGTGC CCAGAAGAAC AAGCCTGGAG TCTACACCAA GGTCTACAAC TATGTGAAAT 781 GGATTAAGAA CACCATAGCT GCCAACAGCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 841 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 901 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGGACT 961 TCGACTGTAA GCTACCGGGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1021 tgaaagatt