Transcript: Human NM_007343.3

Homo sapiens serine protease 3 (PRSS3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
PRSS3 (5646)
Length:
1032
CDS:
52..966

Additional Resources:

NCBI RefSeq record:
NM_007343.3
NBCI Gene record:
PRSS3 (5646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052144 TCTGAGCTTTGGTGCTGACTA pLKO.1 663 CDS 100% 4.950 3.465 N PRSS3 n/a
2 TRCN0000052143 CCTAAATACAACAGGGACACT pLKO.1 511 CDS 100% 2.640 1.848 N PRSS3 n/a
3 TRCN0000378961 TTGACGATGATGACAAGATTG pLKO_005 275 CDS 100% 10.800 6.480 N PRSS3 n/a
4 TRCN0000378960 CATGCTGATCAAACTCTCCTC pLKO_005 546 CDS 100% 2.160 1.296 N PRSS3 n/a
5 TRCN0000052145 CCACCCTAAATACAACAGGGA pLKO.1 507 CDS 100% 0.660 0.396 N PRSS3 n/a
6 TRCN0000052147 CCCTGTGGTCTGCAACGGACA pLKO.1 828 CDS 100% 0.000 0.000 N PRSS3 n/a
7 TRCN0000373255 GGAATGAGCAGTTCATCAATG pLKO_005 470 CDS 100% 10.800 5.400 Y PRSS1 n/a
8 TRCN0000373302 CCTGGAAAGATTACCAACAGC pLKO_005 748 CDS 100% 2.640 1.320 Y PRSS3 n/a
9 TRCN0000052146 GCTACACCTGTGAGGAGAATT pLKO.1 302 CDS 100% 0.000 0.000 Y PRSS3 n/a
10 TRCN0000046733 CCCTGGAAAGATTACCAACAA pLKO.1 747 CDS 100% 4.950 2.475 Y PRSS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06785 pDONR223 100% 74.8% 71% None (many diffs) n/a
2 ccsbBroad304_06785 pLX_304 0% 74.8% 71% V5 (many diffs) n/a
3 TRCN0000470572 ATGCAGTTCGTCAATATCTATCTT pLX_317 55.8% 74.8% 71% V5 (many diffs) n/a
4 ccsbBroadEn_11062 pDONR223 100% 74.1% 71.3% None (many diffs) n/a
5 ccsbBroad304_11062 pLX_304 0% 74.1% 71.3% V5 (many diffs) n/a
6 TRCN0000469423 GGACTTCGACTGTAAGCTACCGGG pLX_317 33.5% 74.1% 71.3% V5 (many diffs) n/a
7 ccsbBroadEn_06784 pDONR223 100% 73.1% 68.7% None (many diffs) n/a
8 ccsbBroad304_06784 pLX_304 0% 73.1% 68.7% V5 (many diffs) n/a
9 TRCN0000477222 GTACCTAGGACCTAGTCATAGTTG pLX_317 46.7% 73.1% 68.7% V5 (many diffs) n/a
10 ccsbBroadEn_11061 pDONR223 100% 72.4% 68% None (many diffs) n/a
11 ccsbBroad304_11061 pLX_304 0% 72.4% 68% V5 (many diffs) n/a
12 TRCN0000479459 CAACACTCTTAGGGCCAGCTAGCC pLX_317 41.3% 72.4% 68% V5 (many diffs) n/a
13 TRCN0000489890 CTGGCACTGACCGGGTAGTTTCTA pLX_317 63.8% 72.4% 68% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV