Construct: ORF TRCN0000469796
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013585.1_s317c1
- Derived from:
- ccsbBroadEn_13309
- DNA Barcode:
- CTCCCAAACTCTTTCCCTACTCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP36 (158763)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469796
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 158763 | ARHGAP36 | Rho GTPase activating prote... | NM_001330651.1 | 100% | 100% | |
2 | human | 158763 | ARHGAP36 | Rho GTPase activating prote... | XM_011531280.1 | 100% | 100% | |
3 | human | 158763 | ARHGAP36 | Rho GTPase activating prote... | NM_001282607.2 | 76.8% | 76.8% | 1_372del |
4 | human | 158763 | ARHGAP36 | Rho GTPase activating prote... | NM_144967.4 | 75.1% | 75.1% | 1_408del |
5 | mouse | 75404 | Arhgap36 | Rho GTPase activating prote... | XM_006541554.3 | 62.3% | 60.4% | (many diffs) |
6 | mouse | 75404 | Arhgap36 | Rho GTPase activating prote... | XM_006541555.2 | 62.3% | 60.4% | (many diffs) |
7 | mouse | 75404 | Arhgap36 | Rho GTPase activating prote... | XM_017318633.1 | 62.3% | 60.4% | (many diffs) |
8 | mouse | 75404 | Arhgap36 | Rho GTPase activating prote... | XM_011251020.1 | 60.4% | 58.5% | (many diffs) |
9 | mouse | 75404 | Arhgap36 | Rho GTPase activating prote... | NM_001081123.1 | 58.8% | 56.9% | (many diffs) |
10 | mouse | 75404 | Arhgap36 | Rho GTPase activating prote... | XM_017318632.1 | 57.6% | 55.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1299
- ORF length:
- 1233
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggttgaagaa gccaccggtc aggctgcggg ccgtcgtcgg ggaaacgtgg 121 tgcgaagggt gtttggccgc atccggcgct ttttcagtcg caggcggaat gagcccacct 181 tgccccggga gttcactcgc cgtgggcgtc gaggtgcagt gtctgtggat agtctggctg 241 agctggaaga cggagccctg ctgctgcaga ccctgcagct ttcaaaaatt tcctttccaa 301 ttggccaacg acttctggga tccaaaagga agatgagtct caatccgatt gcgaaacaaa 361 tcccccaggt tgttgaggct tgctgccaat tcattgaaaa acatggctta agcgcagtgg 421 ggatttttac ccttgaatac tccgtgcagc gagtgcgtca gctccgtgaa gaatttgatc 481 aaggtctgga tgtagtgctg gatgacaatc agaatgtgca tgatgtggct gcactcctca 541 aggagttttt ccgtgacatg aaggattctc tgctgccaga tgatctgtac atgtcattcc 601 tcctgacagc aactttaaag ccccaggatc agctttctgc cctgcagttg ctggtctacc 661 tgatgccacc ctgccacagt gataccctgg agcgtctgct gaaggccctg cataaaatca 721 ctgagaactg cgaggactca attggcattg atggacagtt ggtcccaggc aaccgtatga 781 cttccactaa cttggccttg gtgtttggat ctgctctcct gaaaaaagga aagtttggca 841 agagagagtc caggaaaaca aagctgggga ttgatcacta tgttgcttct gtcaatgtgg 901 tccgtgccat gattgataac tgggatgtcc tcttccaggt gcctccccat attcagaggc 961 aggttgctaa gcgcgtgtgg aagtccagcc cggaagcact tgattttatc agacgcagga 1021 acttgaggaa gatccagagt gcacgcataa agatggaaga ggatgcacta ctttctgatc 1081 cagtggaaac ctctgctgaa gcccgggctg ctgtccttgc tcaaagcaag ccttcTGATG 1141 AAGGTTCCTC TGAGGAGCCA GCTGTGCCTT CCGGCACTGC CCGTTCCCAT GACGATGAGG 1201 AAGGAGCGGG TAACCCTCCC ATTCCGGAGC AAGACCGCCC ATTGCTCCGT GTGCCCCGGG 1261 AGAAGGAGGC CAAAACTGGC GTCAGCTACT TCTTTCCTTA CCCAACTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGACTCCCA AACTCTTTCC CTACTCCAAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt