Transcript: Mouse NM_001081123.1

Mus musculus Rho GTPase activating protein 36 (Arhgap36), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arhgap36 (75404)
Length:
3039
CDS:
158..1930

Additional Resources:

NCBI RefSeq record:
NM_001081123.1
NBCI Gene record:
Arhgap36 (75404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268695 CTTGAGCTCCGTGAGTTATTT pLKO_005 920 CDS 100% 15.000 21.000 N Arhgap36 n/a
2 TRCN0000268751 GATCCAGAGTGCTCGCATAAA pLKO_005 1495 CDS 100% 13.200 18.480 N Arhgap36 n/a
3 TRCN0000283769 TCTATGCAGGACGGTACAAAT pLKO_005 2781 3UTR 100% 13.200 18.480 N Arhgap36 n/a
4 TRCN0000283770 TGTCCGTGCCATGATTGATAA pLKO_005 1363 CDS 100% 13.200 9.240 N Arhgap36 n/a
5 TRCN0000268750 TCCCAGCTTTCATCGCCTATT pLKO_005 746 CDS 100% 10.800 7.560 N Arhgap36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13309 pDONR223 100% 58.8% 56.9% None (many diffs) n/a
2 ccsbBroad304_13309 pLX_304 0% 58.8% 56.9% V5 (many diffs) n/a
3 TRCN0000469796 CTCCCAAACTCTTTCCCTACTCCA pLX_317 13.8% 58.8% 56.9% V5 (many diffs) n/a
Download CSV