Construct: ORF TRCN0000469846
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017191.1_s317c1
- Derived from:
- ccsbBroadEn_04698
- DNA Barcode:
- GACCCTCGTTAGGAGAGAGGGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CYYR1 (116159)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469846
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 116159 | CYYR1 | cysteine and tyrosine rich 1 | NM_052954.5 | 100% | 100% | |
| 2 | human | 116159 | CYYR1 | cysteine and tyrosine rich 1 | NM_001320768.2 | 99.3% | 99.3% | 334_336delGCA |
| 3 | human | 116159 | CYYR1 | cysteine and tyrosine rich 1 | XM_011529450.2 | 47.4% | 43.4% | (many diffs) |
| 4 | human | 116159 | CYYR1 | cysteine and tyrosine rich 1 | XR_001754806.1 | 45% | 1_344del;521_687del;974_1025del | |
| 5 | human | 116159 | CYYR1 | cysteine and tyrosine rich 1 | XR_001754804.2 | 17.1% | 1_344del;521_1658del;1816_1817ins128 | |
| 6 | human | 116159 | CYYR1 | cysteine and tyrosine rich 1 | NR_135472.2 | 14.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 528
- ORF length:
- 462
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgctccgagg ctacccgtgc gtccaggggt cttgcttccg aagttggtcc 121 tgctctttgt ctacgcagat gattgccttg ctcagtgtgg caaagattgc aaatcttact 181 gctgtgatgg aaccacgccc tactgttgct cctactacgc ttatattggg aatatcctct 241 cgggcactgc aattgcgggc attgtttttg gaatagtatt tatcatgggg gtcattgctg 301 ggattgccat atgcatctgc atgtgcatga agaaccacag ggcgacccgc gtgggcatcc 361 tcaggacgac tcacatcaac accgtctcct cctatcctgg accaccaccc tacggtcacg 421 accacgagat ggaatactgt gcagacttgc ctcctccata ctCCCCCACC CCACAGGGTC 481 CAGCACAGCG TTCTCCACCC CCTCCTTATC CTGGAAACGC AAGGAAATAC CCAACTTTCT 541 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 601 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 661 GTGGAAAGGA CGAGACCCTC GTTAGGAGAG AGGGGATACG CGTTAAGTCg acaatcaacc 721 tctggattac aaaatttgtg aaagatt