Transcript: Human NM_052954.5

Homo sapiens cysteine and tyrosine rich 1 (CYYR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CYYR1 (116159)
Length:
3096
CDS:
347..811

Additional Resources:

NCBI RefSeq record:
NM_052954.5
NBCI Gene record:
CYYR1 (116159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052954.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143852 CTCTTTGTCTACGCAGATGAT pLKO.1 404 CDS 100% 4.950 6.930 N CYYR1 n/a
2 TRCN0000142269 GCTCTTTGTCTACGCAGATGA pLKO.1 403 CDS 100% 4.950 6.930 N CYYR1 n/a
3 TRCN0000144567 GATTGCAAATCTTACTGCTGT pLKO.1 446 CDS 100% 2.640 3.696 N CYYR1 n/a
4 TRCN0000141881 GAATACTGTGCAGACTTGCCT pLKO.1 713 CDS 100% 0.750 0.600 N CYYR1 n/a
5 TRCN0000142521 GCCAGGGTTTCTGTGATGATT pLKO.1 2626 3UTR 100% 5.625 3.938 N CYYR1 n/a
6 TRCN0000143114 CCAGGAGTGAATACAACAGAA pLKO.1 1503 3UTR 100% 4.950 3.465 N CYYR1 n/a
7 TRCN0000141283 CCTCAGAAGTTCTGCTCGTAT pLKO.1 1450 3UTR 100% 4.950 3.465 N CYYR1 n/a
8 TRCN0000142145 GACCACGAGATGGAATACTGT pLKO.1 701 CDS 100% 3.000 2.100 N CYYR1 n/a
9 TRCN0000142316 GTCTACGCAGATGATTGCCTT pLKO.1 410 CDS 100% 2.640 1.848 N CYYR1 n/a
10 TRCN0000143658 CATATGCATCTGCATGTGCAT pLKO.1 589 CDS 100% 0.000 0.000 N CYYR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052954.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04698 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04698 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469846 GACCCTCGTTAGGAGAGAGGGGAT pLX_317 15.7% 100% 100% V5 n/a
Download CSV