Construct: ORF TRCN0000469953
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002249.1_s317c1
- Derived from:
- ccsbBroadEn_02284
- DNA Barcode:
- GACCTTCCAAACTTCAAATCAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCO2 (9997)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469953
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9997 | SCO2 | SCO cytochrome c oxidase as... | NM_001169109.1 | 100% | 100% | |
| 2 | human | 9997 | SCO2 | SCO cytochrome c oxidase as... | NM_001169110.1 | 100% | 100% | |
| 3 | human | 9997 | SCO2 | SCO cytochrome c oxidase as... | NM_001169111.1 | 100% | 100% | |
| 4 | human | 9997 | SCO2 | SCO cytochrome c oxidase as... | NM_005138.2 | 100% | 100% |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 867
- ORF length:
- 798
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctgctgctg actcggagcc ccacagcttg gcacaggctc tctcagctca 121 agcctcgggt cctccctggg accctgggag gccaggccct gcatctgagg tcctggcttt 181 tgtcaaggca gggccctgca gagacaggtg ggcagggcca gccccagggc cctgggcttc 241 gaacccggct gctgatcaca ggcctgttcg gggctggact cggtggggcc tggctggccc 301 tgagggctga gaaggagagg ctgcagcagc aaaagcgaac agaagccctg cgccaggcag 361 ctgtgggcca gggcgacttc cacctgctgg atcacagagg ccgggctcgc tgcaaggctg 421 acttccgggg ccagtgggtg ctgatgtact ttggcttcac tcactgccct gacatctgcc 481 cagacgagct ggagaagctg gtgcaggtgg tgcggcagct ggaagcagag cctggtttgc 541 ctccagtgca gcctgtcttc atcactgtgg accccgagcg ggacgacgtt gaagccatgg 601 cccgctacgt ccaggacttc cacccaagac tgttgggtct gaccggctcc accaaacagg 661 ttgcccaggc tagtcacagt taccgcgtgt actacaatgc aggccccaag gatgaggacc 721 aggacTACAT CGTGGACCAC TCCATTGCCA TCTACCTGCT CAACCCTGAC GGCCTCTTCA 781 CGGATTACTA CGGCCGGAGC AGATCGGCTG AGCAGATCTC AGACAGTGTG CGGCGGCACA 841 TGGCGGCTTT CCGCAGTGTC CTGTCTTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 901 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 961 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGACCTTCC 1021 AAACTTCAAA TCAAATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1081 aagatt