Construct: ORF TRCN0000469968
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005377.1_s317c1
- Derived from:
- ccsbBroadEn_03012
- DNA Barcode:
- GGGCGTCGCTTATCTCATAAGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNF115 (27246)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469968
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27246 | RNF115 | ring finger protein 115 | NM_014455.4 | 100% | 100% | |
2 | human | 27246 | RNF115 | ring finger protein 115 | XM_005272952.5 | 85.4% | 83.6% | (many diffs) |
3 | human | 27246 | RNF115 | ring finger protein 115 | XR_001737118.2 | 49.3% | 1_199del;698_699ins73;1039_1628del | |
4 | mouse | 67845 | Rnf115 | ring finger protein 115 | NM_026406.3 | 90.9% | 92.7% | (many diffs) |
5 | mouse | 67845 | Rnf115 | ring finger protein 115 | XM_006501947.3 | 79.1% | 81.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 978
- ORF length:
- 912
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggaggcttcg gcggccgggg cggactcggg cgccgctgta gccgcccacc 121 ggtttttctg ccacttttgc aagggcgagg tcagccccaa actaccggaa tatatatgtc 181 ccagatgtga atcaggcttt attgaagaag tgacagatga ttccagtttt ttaggtggtg 241 gcggcagtcg gatagacaat accacaacaa cacattttgc agagctttgg ggccatttgg 301 atcacacgat gttttttcaa gattttagac cctttctaag tagcagtcca ctggaccaag 361 ataatagagc caatgaaagg ggtcaccaga ctcacactga cttctgggga gcaagacctc 421 cacggttgcc attgggtcgg agatacagat ctcgaggaag ttctcgtcct gacagatctc 481 cagctattga aggaatacta caacacatct ttgcaggatt ctttGCAAAT TCTGCCATTC 541 CTGGATCTCC ACACCCTTTT TCCTGGAGCG GGATGCTGCA CTCCAACCCT GGGGACTATG 601 CCTGGGGTCA GACAGGGCTT GATGCCATTG TAACCCAGCT TTTAGGACAA CTGGAAAACA 661 CAGGCCCTCC CCCAGCTGAC AAGGAAAAGA TCACATCTCT TCCAACAGTG ACAGTAACTC 721 AGGAACAAGT TGATATGGGT TTAGAGTGTC CAGTATGCAA AGAAGATTAC ACAGTTGAAG 781 AGGAAGTCCG GCAGTTACCT TGCAATCACT TCTTTCACAG CAGTTGTATT GTGCCGTGGC 841 TAGAACTGCA TGACACATGT CCTGTATGTA GGAAGAGCTT AAATGGTGAG GACTCTACTC 901 GGCAAAGCCA GAGCACTGAG GCCTCTGCAA GCAACAGATT TAGCAATGAC AGTCAGCTAC 961 ATGACCGATG GACTTTCTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1021 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1081 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGGGCGTC GCTTATCTCA 1141 TAAGCACACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt