Construct: ORF TRCN0000469983
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007007.1_s317c1
- Derived from:
- ccsbBroadEn_15290
- DNA Barcode:
- CCGGCCTACTGGTGTGCCCTTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C6orf223 (221416)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469983
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221416 | C6orf223 | chromosome 6 open reading f... | NR_160954.1 | 12.5% | (many diffs) | |
| 2 | human | 221416 | C6orf223 | chromosome 6 open reading f... | NR_160955.1 | 12.5% | 1_138del;447_448insGCG;804_5293delinsG | |
| 3 | human | 221416 | C6orf223 | chromosome 6 open reading f... | NR_160956.1 | 11.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 735
- ORF length:
- 669
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gggctctttt caccagaaga cccccaggca caagcagccc accttactga 121 tggtcagagc atccagaaga agtggcaaga cttcagctgt cctcaaagca ggaagacaga 181 gtgtttctgg cagaaagaac agcacaagca aagatctggt aaccctaggt gcctccagtt 241 tgagggagga gagaggacac cccctccacc ccagacatag gaaagcagtc cacctgcgca 301 ccaggggcag gacacgtggc tgggtgcaga cgctggcccg gatgtcgcgg aggactcgcg 361 ggccggtaga gcgcgcggcg gcggcggcgg cggcggcggc ggcgggagga gacgcaggtc 421 acgccccctt cccaccaCCT CCCGCCGCCG ACGGGGCGCG CGCGCCGAGG AGCCCGGGAC 481 AGGTGACTCC TAGAGGACTG CGTCTGCGCC TCCCCCGGCG GGAGTCCCTT CTTCGCGGCC 541 TCTGCCGCCC CCTGCGTCCC CTCCTGGGCT TCCGAGAGTC TGACTCAGCC AAGCCGGCAT 601 CGCTTCGCCT CCTACAACAC ACCCCGAGCG CGAGAAGAAA TTACAGGATT GCAGGGGCAC 661 GGCTAATGCG CTCTAATTAC CCACCGCCGC TGTCATCCGC GGCGCTCCGC GGCGCTGGGC 721 CAACGCGCCG TAAGTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 781 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 841 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCGGCCTACT GGTGTGCCCT 901 TGCAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt