Transcript: Human NR_160956.1

Homo sapiens chromosome 6 open reading frame 223 (C6orf223), transcript variant 3, long non-coding RNA.

Source:
NCBI, updated 2019-03-15
Taxon:
Homo sapiens (human)
Gene:
C6orf223 (221416)
Length:
5123
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160956.1
NBCI Gene record:
C6orf223 (221416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130984 CGAGCGCGAGAAGAAATTACA pLKO.1 525 3UTR 100% 5.625 7.875 N C6orf223 n/a
2 TRCN0000427374 ATCGCTTCGCCTCCTACAACA pLKO_005 499 3UTR 100% 4.950 6.930 N C6orf223 n/a
3 TRCN0000130925 CGCTCGTTTAACAGTGGCTTT pLKO.1 1034 3UTR 100% 4.050 5.670 N C6orf223 n/a
4 TRCN0000421678 TAACCCTAGGTGCCTCCAGTT pLKO_005 123 3UTR 100% 4.050 2.835 N C6orf223 n/a
5 TRCN0000148828 CGCGAGAAGAAATTACAGGAT pLKO.1 529 3UTR 100% 2.640 1.848 N C6orf223 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469983 CCGGCCTACTGGTGTGCCCTTGCA pLX_317 44.7% 11.1% V5 (many diffs) n/a
2 ccsbBroadEn_15290 pDONR223 94.4% 11% None (many diffs) n/a
3 ccsbBroad304_15290 pLX_304 0% 11% V5 (many diffs) n/a
Download CSV