Construct: ORF TRCN0000470057
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000456.1_s317c1
- Derived from:
- ccsbBroadEn_08076
- DNA Barcode:
- TAGCCAAGTTTGTTGCATTGCTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SULT1B1 (27284)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470057
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27284 | SULT1B1 | sulfotransferase family 1B ... | NM_014465.4 | 99.7% | 99.3% | 548A>G;878G>T |
2 | human | 27284 | SULT1B1 | sulfotransferase family 1B ... | XM_005265677.3 | 99.7% | 99.3% | 548A>G;878G>T |
3 | human | 27284 | SULT1B1 | sulfotransferase family 1B ... | XM_005265676.3 | 97.5% | 96% | (many diffs) |
4 | human | 27284 | SULT1B1 | sulfotransferase family 1B ... | XM_005265678.3 | 93.3% | 92.9% | 0_1ins57;491A>G;821G>T |
5 | human | 27284 | SULT1B1 | sulfotransferase family 1B ... | XM_011531873.2 | 79.8% | 79.3% | 0_1ins177;371A>G;701G>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 954
- ORF length:
- 888
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ttccccaaaa gatattctgc gaaaagatct gaagttggtc catggttatc 121 ccatgacctg tgcttttgca agcaactggg aaaaaattga acagttccat agcagaccag 181 atgacattgt gatagccact tatcctaaat caggtactac ttgggttagt gaaattatag 241 acatgattct aaatgatgga gatattgaaa aatgtaagcg aggttttatt actgaaaaag 301 ttccaatgtt ggaaatgact ctccctggat taagaacatc aggtatagaa caattggaga 361 agaatccatc accccggatt gtgaaaacac atctaccgac tgatcttctt cctaaatctt 421 tctgggaaaa caattgcaag atgatttatc tggctcgtaa tgccaaggat gtttcagtct 481 catattacca ttttgactta atgaataatt tacagccttt tcctggtacc tgggaagaat 541 atctggagaa attcttaact ggaaaagtgg ccTATGGTTC CTGGTTTACT CATGTTAAAA 601 ACTGGTGGAA GAGAAAGGAA GAACACCCAA TACTTTTTTT GTACTATGAA GATATGAAAG 661 AGAATCCAAA GGAGGAAATC AAGAAGATCA TTAGATTTCT AGAGAAGAAC CTGAATGATG 721 AGATCTTGGA TAGGATCATC CATCACACCT CATTTGAAGT GATGAAGGAC AATCCTTTGG 781 TAAATTATAC ACATCTACCA ACTACAGTGA TGGATCATAG CAAATCCCCT TTTATGCGTA 841 AAGGGACGGC TGGTGACTGG AAGAATTACT TCACCGTGGC CCAAAATGAG AAATTTGATG 901 CTATTTATGA GACAGAAATG TCCAAAACTG CACTTCAATT CCTCACAGAG ATTTACCCAA 961 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1021 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1081 TATCTTGTGG AAAGGACGAT AGCCAAGTTT GTTGCATTGC TTTACGCGTT AAGTCgacaa 1141 tcaacctctg gattacaaaa tttgtgaaag att