Transcript: Human XM_005265678.3

PREDICTED: Homo sapiens sulfotransferase family 1B member 1 (SULT1B1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SULT1B1 (27284)
Length:
1297
CDS:
224..1057

Additional Resources:

NCBI RefSeq record:
XM_005265678.3
NBCI Gene record:
SULT1B1 (27284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426352 GACAATCCTTTGGTAAATTAT pLKO_005 869 CDS 100% 15.000 21.000 N SULT1B1 n/a
2 TRCN0000034994 CGACTGATCTTCTTCCTAAAT pLKO.1 498 CDS 100% 13.200 18.480 N SULT1B1 n/a
3 TRCN0000433327 ATGATTTATCTGGCTCGTAAT pLKO_005 542 CDS 100% 10.800 15.120 N SULT1B1 n/a
4 TRCN0000034995 CCAAGGATGTTTCAGTCTCAT pLKO.1 564 CDS 100% 4.950 3.960 N SULT1B1 n/a
5 TRCN0000034997 GACATTGTGATAGCCACTTAT pLKO.1 284 CDS 100% 13.200 9.240 N SULT1B1 n/a
6 TRCN0000421966 TACTACTTGGGTTAGTGAAAT pLKO_005 316 CDS 100% 13.200 9.240 N SULT1B1 n/a
7 TRCN0000420794 TGAAGTTGGTCCATGGTTATC pLKO_005 201 5UTR 100% 10.800 7.560 N SULT1B1 n/a
8 TRCN0000034996 CCAACTACAGTGATGGATCAT pLKO.1 899 CDS 100% 4.950 3.465 N SULT1B1 n/a
9 TRCN0000034998 CTGGGAAGAATATCTGGAGAA pLKO.1 631 CDS 100% 4.050 2.835 N SULT1B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08076 pDONR223 100% 93.3% 92.9% None 0_1ins57;491A>G;821G>T n/a
2 ccsbBroad304_08076 pLX_304 0% 93.3% 92.9% V5 0_1ins57;491A>G;821G>T n/a
3 TRCN0000470057 TAGCCAAGTTTGTTGCATTGCTTT pLX_317 43.1% 93.3% 92.9% V5 0_1ins57;491A>G;821G>T n/a
Download CSV