Construct: ORF TRCN0000470265
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018940.3_s317c1
- Derived from:
- ccsbBroadEn_15138
- DNA Barcode:
- GCAGACGAGACTTCTACCCATGTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PINK1 (65018)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470265
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65018 | PINK1 | PTEN induced kinase 1 | NM_032409.3 | 96.8% | 32.2% | (many diffs) |
| 2 | human | 102464833 | MIR6084 | microRNA 6084 | NR_106732.1 | 6.5% | 0_1ins82;110_111ins1500 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 906
- ORF length:
- 837
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggtgcga caggcgctgg gccgcggcct gcagctgggt cgagcgctgc 121 tgctgcgctt cacgggctgt gtccgcgggg agcgtccagg ctgggccgca ggaccgggcg 181 cggagcctcg cagggtcggg ctcgggctcc ctaaccgtct ccgcttcttc cgccagtcgg 241 tggccgggct ggcggcgcgg ttgcagcggc agttcgtggt gcgggcctgg ggctgcgcgg 301 gcccttgcgg ccgggcagtc tttctggcct tcgggctagg gctgggcctc atcgaggaaa 361 aacaggcgga gagccggcgg gcggtctcgg cctgtcagga gatccaggca atttttaccc 421 agaaaagcaa gccggggcct gacccgttgg acacgagacg cttgcagggc tttcggctgg 481 aggagtatct gatagggcag tccattggta agggctgcag tgctgctgtg tatgaagcca 541 ccatgcctac attgccccag aacctggagg tgacaaagag caccgggttg cttccaggga 601 gaggcccagt accagtgcac cagagaaggg caggagcgag ctccgggggc ccctgccttc 661 cccttggcca tcaagatgat gtggaacatc tcggcaggtt cctccagcga agccatcttg 721 aacacaatga gccaggagct ggtcccagcg agccgagtgg ccttggcttg agggtatgga 781 gcagtcactt acagaaaatc caagagaggt cccaagcaac tagcccctca ccccaacatc 841 atccgggttc tccgcgcctt cacctcttcc gtgccgctgc tgccaggggc cctggtcgac 901 taccctgatg tgctgccctc acgcctccac cctgaaggcc tgggccatgg ccggacgctg 961 ttcctcgtta tgaagaacta tccctgtacc ctgcgccagt acctttgtgt gaacacaccc 1021 agcccccgcc tcggcgccat gatgctgctg cagctgctgg aaggcgtgga ccatctggtt 1081 caacagggca tcgcgcacag agactgaaat ccgacaacat ccttgtggag ctggacccag 1141 acggctgccc ctggctggtg atcgcagatt ttggctgctg cctggctgat gagagcatcg 1201 gcctgcagtt gcccttcagc agctggtacg tggatcgggg cggaaacggc tgtctgatgg 1261 ccccagaggt gtccacggcc cgtcctggcc ccagggcagt gattgactac agcaaggctg 1321 atgcctgggc agtgggagcc atcgcctatg aaatcttcgg gcttgtcaat cccttctacg 1381 gccagggcaa ggcccacctt gaaagccgca gctaccaaga ggctcagcta cctgcactgc 1441 ccgagtcagt gcctccagac gtgagacagt tggtgagggc actgctccag cgagaggcca 1501 gcaagagacc atctgcccga gtagccgcaa atgtgcttca tcTAAGCCTC TGGGGTGAAC 1561 ATATTCTAGC CCTGAAGAAT CTGAAGTTAG ACAAGATGGT TGGCTGGCTC CTCCAACAAT 1621 CGGCCGCCAC TTTGTTGGCC AACAGGCTCA CAGAGAAGTG TTGTGTGGAA ACAAAAATGA 1681 AGATGCTCTT TCTGGCTAAC CTGGAGTGTG AAACGCTCTG CCAGGCAGCC CTCCTCCTCT 1741 GCTCATGGAG GGCAGCCCTG TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1801 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1861 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGCAG ACGAGACTTC 1921 TACCCATGTA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt