Construct: ORF TRCN0000470311
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011746.1_s317c1
- Derived from:
- ccsbBroadEn_04260
- DNA Barcode:
- CCTGCCTAAGATCGAACGACCAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SFXN3 (81855)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470311
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 81855 | SFXN3 | sideroflexin 3 | NM_030971.3 | 100% | 100% | |
2 | human | 81855 | SFXN3 | sideroflexin 3 | NR_157572.1 | 30.9% | 1_461del;979_1034del;1493_3151del | |
3 | human | 81855 | SFXN3 | sideroflexin 3 | XR_945825.3 | 22.7% | 1_447del;1229_2439del;2634_4294del | |
4 | mouse | 94280 | Sfxn3 | sideroflexin 3 | NM_053197.4 | 87.3% | 92.6% | (many diffs) |
5 | mouse | 94280 | Sfxn3 | sideroflexin 3 | XM_006527493.2 | 87.3% | 92.6% | (many diffs) |
6 | mouse | 94280 | Sfxn3 | sideroflexin 3 | NM_001178012.1 | 78.7% | 83% | (many diffs) |
7 | mouse | 94280 | Sfxn3 | sideroflexin 3 | NM_001178013.1 | 76.2% | 81.2% | (many diffs) |
8 | mouse | 94280 | Sfxn3 | sideroflexin 3 | XM_006527495.2 | 74.8% | 78.1% | (many diffs) |
9 | mouse | 94280 | Sfxn3 | sideroflexin 3 | XM_006527496.2 | 63% | 66.1% | (many diffs) |
10 | mouse | 94280 | Sfxn3 | sideroflexin 3 | XM_017318317.1 | 63% | 66.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1041
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga aagcaaaatg ggtgaattgc ctttagacat caacatccag gaacctcgct 121 gggaccaaag tactttcctg ggcagagccc ggcacttttt cactgttact gatcctcgaa 181 atctgctgct gtccggggca cagctggaag cttctcggaa catcgtgcag aactacaggg 241 ccggcgtggt gaccccaggg atcaccgagg accagctgtg gagggccaag tatgtgtatg 301 actccgcctt ccatccggac acaggggaga aggtggtcct gattggccgc atgtcagccc 361 aggtgcccat gaacatgacc atcactggct gcatgctcac attctacagg aagaccccaa 421 ccgtggtgtt ctggcagtgg gtgaatcagt ccttcaatgc cattgttaac tactccaacc 481 gcagtggtga cactcccatc actgtgaggc agctggggac agcctatgtg agtgccacca 541 ctggagctgt ggccacggcc ctgggactca aatccctcac caagcacctg ccccccttgg 601 tcggcagatt tgtgcccttt gcagcagtgg cagctgccaa ctgcatcaac atccccctga 661 tgaggcagag agagctgcag gtgggcatcc cggtggctga tgaggcaggt cagaggcttG 721 GCTACTCGGT GACTGCAGCC AAGCAGGGAA TCTTCCAGGT GGTGATTTCA AGAATCTGCA 781 TGGCGATTCC TGCCATGGCC ATCCCACCAC TGATCATGGA CACTCTGGAG AAGAAAGACT 841 TCCTGAAGCG CCGCCCCTGG CTGGGGGCAC CCCTGCAGGT GGGACTGGTG GGCTTCTGCC 901 TGGTATTTGC AACCCCCCTG TGCTGTGCCC TATTCCCCCA GAAGAGCTCC ATACACATAA 961 GCAACCTGGA ACCAGAGCTG AGAGCTCAGA TCCATGAGCA AAACCCCAGC GTTGAAGTGG 1021 TCTACTACAA CAAGGGGCTT TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCTG CCTAAGATCG 1201 AACGACCAGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt