Transcript: Human NM_030971.3

Homo sapiens sideroflexin 3 (SFXN3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SFXN3 (81855)
Length:
3129
CDS:
457..1434

Additional Resources:

NCBI RefSeq record:
NM_030971.3
NBCI Gene record:
SFXN3 (81855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118142 GCGGTAGGAATGGTGCTTAAA pLKO.1 2317 3UTR 100% 13.200 18.480 N SFXN3 n/a
2 TRCN0000118145 CAGCGTTGAAGTGGTCTACTA pLKO.1 1398 CDS 100% 4.950 6.930 N SFXN3 n/a
3 TRCN0000424278 ACTGGCTGCATGCTCACATTC pLKO_005 775 CDS 100% 10.800 8.640 N SFXN3 n/a
4 TRCN0000435535 TCGGCAGATTTGTGCCCTTTG pLKO_005 992 CDS 100% 6.000 4.800 N SFXN3 n/a
5 TRCN0000420087 AGAAGAGCTCCATACACATAA pLKO_005 1331 CDS 100% 13.200 9.240 N SFXN3 n/a
6 TRCN0000423316 ACTGTTACTGATCCTCGAAAT pLKO_005 553 CDS 100% 10.800 7.560 N SFXN3 n/a
7 TRCN0000427512 CGCTGGGACCAAAGTACTTTC pLKO_005 508 CDS 100% 10.800 7.560 N SFXN3 n/a
8 TRCN0000118144 CAGTCCTTCAATGCCATTGTT pLKO.1 838 CDS 100% 5.625 3.938 N SFXN3 n/a
9 TRCN0000118143 CCAGGTGGTGATTTCAAGAAT pLKO.1 1146 CDS 100% 5.625 3.938 N SFXN3 n/a
10 TRCN0000118146 CACTCTGGAGAAGAAAGACTT pLKO.1 1212 CDS 100% 4.950 3.465 N SFXN3 n/a
11 TRCN0000434863 GGACTCAAATCCCTCACCAAG pLKO_005 955 CDS 100% 4.050 2.835 N SFXN3 n/a
12 TRCN0000425614 GGCCAAGTATGTGTATGACTC pLKO_005 675 CDS 100% 4.050 2.835 N SFXN3 n/a
13 TRCN0000105563 GTGCCCATGAACATGACCATT pLKO.1 754 CDS 100% 4.950 2.970 N Sfxn3 n/a
14 TRCN0000325777 GTGCCCATGAACATGACCATT pLKO_005 754 CDS 100% 4.950 2.970 N Sfxn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04260 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04260 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470311 CCTGCCTAAGATCGAACGACCAGT pLX_317 33.3% 100% 100% V5 n/a
Download CSV