Construct: ORF TRCN0000470321
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013292.1_s317c1
- Derived from:
- ccsbBroadEn_03536
- DNA Barcode:
- GCGCGCTCATTAGGGTGGTACCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MSTO1 (55154)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470321
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_018116.3 | 100% | 100% | |
| 2 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001256532.1 | 99.8% | 99.8% | 1493_1494insAGC |
| 3 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350772.1 | 98% | 98% | 1464_1465ins33 |
| 4 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001256533.1 | 97.8% | 97.8% | 1464_1465ins36 |
| 5 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350775.1 | 94.3% | 88% | 1496_1520del;1662_1663ins73 |
| 6 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350773.1 | 93.7% | 73.9% | 1282_1318del;1674_1675ins73 |
| 7 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350774.1 | 93.5% | 74% | 1282_1318del;1530_1531insAGC;1671_1672ins73 |
| 8 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509695.2 | 92.6% | 70.4% | 1282_1318del;1533_1557del;1704_1705ins68 |
| 9 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509700.2 | 91.8% | 74.7% | 1282_1318del;1501_1502ins33;1641_1642ins73 |
| 10 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509701.2 | 91.6% | 74.8% | 1282_1318del;1501_1502ins36;1638_1639ins73 |
| 11 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509702.2 | 91% | 91% | 813_814ins153 |
| 12 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_024448039.1 | 87.8% | 87.8% | 0_1ins207 |
| 13 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350776.1 | 77.6% | 80.5% | 0_1ins287;78_199del |
| 14 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509703.2 | 77.6% | 80.5% | 0_1ins287;78_199del |
| 15 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509704.2 | 77.6% | 80.5% | 0_1ins287;78_199del |
| 16 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509705.1 | 77.6% | 80.5% | 0_1ins287;78_199del |
| 17 | human | 55154 | MSTO1 | misato mitochondrial distri... | XR_001737275.2 | 70% | (many diffs) | |
| 18 | human | 55154 | MSTO1 | misato mitochondrial distri... | XR_001737273.2 | 69.3% | (many diffs) | |
| 19 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350780.1 | 68.7% | 68.7% | 0_1ins534 |
| 20 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350781.1 | 68.7% | 68.7% | 0_1ins534 |
| 21 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350782.1 | 68.7% | 68.7% | 0_1ins534 |
| 22 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509707.2 | 68.7% | 68.7% | 0_1ins534 |
| 23 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_017001606.2 | 68.7% | 68.7% | 0_1ins534 |
| 24 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_024448042.1 | 68.7% | 68.7% | 0_1ins534 |
| 25 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350783.1 | 68.5% | 68.5% | 0_1ins534;959_960insAGC |
| 26 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509708.2 | 68.5% | 68.5% | 0_1ins534;959_960insAGC |
| 27 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350777.1 | 68.5% | 66.4% | (many diffs) |
| 28 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350778.1 | 68.5% | 66.4% | (many diffs) |
| 29 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350779.1 | 68.5% | 66.4% | (many diffs) |
| 30 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_017001605.2 | 68.5% | 66.4% | (many diffs) |
| 31 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350784.1 | 67.5% | 67.1% | (many diffs) |
| 32 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350785.1 | 67.5% | 67.1% | (many diffs) |
| 33 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_024448043.1 | 67.5% | 67.1% | (many diffs) |
| 34 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_024448044.1 | 67.5% | 67.1% | (many diffs) |
| 35 | human | 55154 | MSTO1 | misato mitochondrial distri... | NR_146908.1 | 67.3% | 1_79del;1046_1083del;1828_2538del | |
| 36 | human | 55154 | MSTO1 | misato mitochondrial distri... | NR_146907.1 | 66.6% | 1_79del;1175_1176ins43;1747_2457del | |
| 37 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350787.1 | 65.6% | 65.2% | (many diffs) |
| 38 | human | 55154 | MSTO1 | misato mitochondrial distri... | NR_046293.1 | 65.4% | (many diffs) | |
| 39 | human | 55154 | MSTO1 | misato mitochondrial distri... | NR_046295.1 | 65.3% | 1_79del;368_369ins76;1714_2424del | |
| 40 | human | 100129405 | MSTO2P | misato family member 2, pse... | NR_024117.2 | 64.8% | (many diffs) | |
| 41 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_011509709.3 | 64.3% | 64.2% | 1097_1098insG;1101_1102ins608 |
| 42 | human | 55154 | MSTO1 | misato mitochondrial distri... | NR_046292.1 | 63.9% | (many diffs) | |
| 43 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350788.1 | 63.5% | 57.6% | 0_1ins534;962_986del;1128_1129ins73 |
| 44 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350786.1 | 63.1% | 45.2% | 0_1ins534;748_784del;1140_1141ins73 |
| 45 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_024448046.1 | 62.9% | 43.4% | (many diffs) |
| 46 | human | 55154 | MSTO1 | misato mitochondrial distri... | NM_001350789.1 | 62.4% | 56% | (many diffs) |
| 47 | human | 55154 | MSTO1 | misato mitochondrial distri... | XR_002956984.1 | 61.8% | (many diffs) | |
| 48 | human | 55154 | MSTO1 | misato mitochondrial distri... | NR_046294.1 | 61% | (many diffs) | |
| 49 | human | 55154 | MSTO1 | misato mitochondrial distri... | XM_024448048.1 | 59.6% | 57.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1776
- ORF length:
- 1710
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gggcggggcc cgggaggtgc tcacactgca gttgggacat tttgccggtt 121 tcgtgggcgc gcactggtgg aaccagcagg atgctgcgct gggccgagcg accgattcca 181 aggagccccc gggagagctg tgccccgacg tcctgtatcg tacgggccgg acgctgcacg 241 gccaggagac ctacacgccg cgactcatcc tcatggatct gaagggtagt ttgagctccc 301 taaaagagga aggtggactc tacagggaca aacagttgga tgctgcaata gcatggcagg 361 ggaagctcac cacacacaaa gaggaactct atcccaagaa cccttatctc caagactttc 421 tgagtgcaga gggagtgctg agtagtgatg gtgtctggag ggtcaaatcc attcccaatg 481 gcaaaggttc ctcaccactc cccaccgcta caactccaaa accacttatc cctacagagg 541 ccagcatcag ggtctggtca gacttcctca gagtccatct ccatccccgg agcatctgta 601 tgattcagaa gtacaaccac gatggggaag caggtcggct ggaggctttt ggccaagggg 661 aaagtgtcct aaaggaaccc aagtaccagg aagagctgga ggacaggctg catttctacg 721 tggaggaatg tgactacttg cagggcttcc agatcctgtg tgacctgcac gatggcttct 781 ctggggtagg cgcgaaggcg gcagagctgc tacaagatga atattcaggg cggggaataa 841 taacctgggg cctgctacct ggtccctacc atcgtgggga ggcccagaga aacatctatc 901 gtctattaaa cacagctttt ggtctcgtgc acctgactgc tcacagctct cttgtctgcc 961 ccttgtcctt gggtgggagc ctgggcctgc gacccgagcc acctgtcagc ttcccttacc 1021 tgcattatga tgccactctg cccttccact gcagtgccat cctggctaca gccctggaca 1081 cagtcactgt tccttatcgc ctgtgttcct ctccagtttc catggttcat ctggctgaca 1141 tgctgagctt ctgtgggaaa aaggtggtga cagcaggagc aatcatccct ttccccttgg 1201 ctccaggcca gtcccttcct gattccctga tgcagtttgg aggagccacc ccatggaccc 1261 cactgtctgc atgtggggag ccttctggaa cacgttgctt tgcccagtca gtggtgctga 1321 ggggtataga cagagcatgc cacacaagcc agctcacccc agggacacct ccaccctctg 1381 cccttcatgc atgtaccact ggggaagaaa tcttggctca gtatttacaa cagcagcagc 1441 ctGGAGTCAT GAGTTCTTCC CATCTGCTGC TGACTCCCTG CAGGGTGGCT CCTCCTTACC 1501 CCCACCTCTT CTCAAGCTGC AGTCCACCGG GTATGGTTCT GGATGGTTCC CCCAAGGGAG 1561 CAGCAGTGGA GAGCATCCCA GTGTTTGGGG CACTGTGTTC CTCTTCGTCC CTGCACCAGA 1621 CCCTGGAAGC CTTGGCCAGA GACCTCACCA AACTCGACTT GCGGCGCTGG GCCAGCTTCA 1681 TGGATGCTGG AGTGGAGCAC GATGACGTAG CAGAGCTGCT GCAGGAGCTA CAAAGCCTGG 1741 CCCAGTGCTA CCAGGGTGGT GACAGCCTCG TGGACTACCC AACTTTCTTG TACAAAGTGG 1801 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1861 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1921 AGCGCGCTCA TTAGGGTGGT ACCGTACGCG TTAAGTCgac aatcaacctc tggattacaa 1981 aatttgtgaa agatt