Transcript: Human XM_024448043.1

PREDICTED: Homo sapiens misato mitochondrial distribution and morphology regulator 1 (MSTO1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MSTO1 (55154)
Length:
2697
CDS:
865..2034

Additional Resources:

NCBI RefSeq record:
XM_024448043.1
NBCI Gene record:
MSTO1 (55154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413348 GAAACATCTATCGTCTATTAA pLKO_005 1145 CDS 100% 15.000 21.000 N MSTO1 n/a
2 TRCN0000436362 ACTGCTCACAGCTCTCTTGTC pLKO_005 1192 CDS 100% 4.050 2.835 N MSTO1 n/a
3 TRCN0000122232 GATGCTACTTACAGAGGACAT pLKO.1 2248 3UTR 100% 4.050 2.430 N MSTO1 n/a
4 TRCN0000141016 CCGGAGCATCTGTATGATTCA pLKO.1 781 5UTR 100% 4.950 2.475 Y MSTO1 n/a
5 TRCN0000141314 CCTGATTCCCTGATGCAGTTT pLKO.1 1474 CDS 100% 4.950 2.475 Y MSTO1 n/a
6 TRCN0000141662 CTGTTCCTTATCGCCTGTGTT pLKO.1 1343 CDS 100% 4.950 2.475 Y MSTO1 n/a
7 TRCN0000122002 GAAGAAATCTTGGCTCAGTAT pLKO.1 1660 CDS 100% 4.950 2.475 Y MSTO1 n/a
8 TRCN0000142028 GCAGAGCTGCTACAAGATGAA pLKO.1 1057 CDS 100% 4.950 2.475 Y MSTO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03536 pDONR223 100% 67.5% 67.1% None (many diffs) n/a
2 ccsbBroad304_03536 pLX_304 0% 67.5% 67.1% V5 (many diffs) n/a
3 TRCN0000470321 GCGCGCTCATTAGGGTGGTACCGT pLX_317 19.8% 67.5% 67.1% V5 (many diffs) n/a
Download CSV