Construct: ORF TRCN0000470437
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010525.1_s317c1
- Derived from:
- ccsbBroadEn_04509
- DNA Barcode:
- TAATGCTCCATTTCGAGTAGACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CEACAM21 (90273)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470437
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | NM_001098506.4 | 100% | 100% | |
| 2 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_005278396.4 | 100% | 100% | |
| 3 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | NM_033543.6 | 99.6% | 99.3% | 700_701insCAG |
| 4 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_005278397.4 | 99.6% | 99.3% | 700_701insCAG |
| 5 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027430.1 | 93.4% | 87.5% | (many diffs) |
| 6 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027431.1 | 93.4% | 87.5% | (many diffs) |
| 7 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027432.2 | 93.1% | 86.9% | (many diffs) |
| 8 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | NM_001288773.3 | 54.8% | 51.8% | (many diffs) |
| 9 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_011527450.1 | 54.8% | 51.8% | (many diffs) |
| 10 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_011527452.1 | 54.8% | 51.8% | (many diffs) |
| 11 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027433.1 | 54.8% | 51.8% | (many diffs) |
| 12 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451755.1 | 54.8% | 51.8% | (many diffs) |
| 13 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451756.1 | 54.8% | 51.8% | (many diffs) |
| 14 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451757.1 | 54.8% | 51.8% | (many diffs) |
| 15 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451758.1 | 54.8% | 51.8% | (many diffs) |
| 16 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451759.1 | 54.8% | 51.8% | (many diffs) |
| 17 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451760.1 | 54.8% | 51.8% | (many diffs) |
| 18 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451761.1 | 54.8% | 51.8% | (many diffs) |
| 19 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451762.1 | 54.8% | 51.8% | (many diffs) |
| 20 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451763.1 | 54.8% | 51.8% | (many diffs) |
| 21 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451764.1 | 54.8% | 51.8% | (many diffs) |
| 22 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451765.1 | 54.8% | 51.8% | (many diffs) |
| 23 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451766.1 | 54.8% | 51.8% | (many diffs) |
| 24 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451767.1 | 54.8% | 51.8% | (many diffs) |
| 25 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451768.1 | 54.8% | 51.8% | (many diffs) |
| 26 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_024451769.1 | 54.8% | 51.8% | (many diffs) |
| 27 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | NM_001290113.2 | 54.5% | 51.1% | (many diffs) |
| 28 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027434.2 | 54.5% | 51.1% | (many diffs) |
| 29 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027435.2 | 54.5% | 51.1% | (many diffs) |
| 30 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027436.1 | 54.5% | 51.1% | (many diffs) |
| 31 | human | 90273 | CEACAM21 | CEA cell adhesion molecule 21 | XM_017027437.2 | 54.5% | 51.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 948
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggggcccccc tcagcttgtc cccacagaga atgcatcccc tggcaggggc 121 tcttgctcac agcctcactt ttaactttct ggaacgcacc caccactgcc tggctcttta 181 ttgcatcagc gccctttgaa gttgctgaag gggagaatgt tcatctctct gtggtttatc 241 tgcccgagaa tctttacagc tatggctggt acaaagggaa aacggtggag cccaaccagc 301 taatcgcagc atatgtaata gacactcacg ttaggactcc agggcctgca tacagcggtc 361 gagagacaat atcacccagt ggagatctgc atttccagaa cgtcacccta gaggacacgg 421 gatactacaa cctacaagtc acatacagaa attctcagat tgaacaggca tctcaccatc 481 tccgtgtata cgagtcagtg gctcagccct ccaTCCAAGC CAGCAGCACC ACAGTCACAG 541 AGAAGGGCTC CGTGGTCCTG ACCTGCCACA CAAATAACAC TGGAACCTCT TTCCAGTGGA 601 TTTTCAACAA CCAGCGTCTG CAGGTCACGA AGAGGATGAA GCTGTCCTGG TTTAACCATG 661 TGCTCACCAT AGACCCCATC AGGCAGGAGG ACGCTGGGGA GTATCAGTGT GAGGTCTCCA 721 ACCCAGTCAG CTCCAACAGG AGCGACCCCC TCAAGCTGAC TGTAAAATCA GATGACAACA 781 CTCTAGGCAT CCTGATCGGG GTCCTGGTTG GGAGTCTTCT GGTGGCTGCA CTTGTGTGTT 841 TCCTGCTCCT CCGAAAAACT GGCAGGGCCA GCGATCAGAG TGACTTCAGG GAGCAGCAGC 901 CCCCAGCCTC CACCCCCGGC CATGGACCCT CTGACAGCTC CATCTCCTTG CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGATAATGCT CCATTTCGAG TAGACTAACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt