Transcript: Human XM_011527450.1

PREDICTED: Homo sapiens CEA cell adhesion molecule 21 (CEACAM21), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEACAM21 (90273)
Length:
1772
CDS:
852..1349

Additional Resources:

NCBI RefSeq record:
XM_011527450.1
NBCI Gene record:
CEACAM21 (90273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527450.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371768 ATCTCACCATCTCCGTGTATA pLKO_005 786 5UTR 100% 13.200 9.240 N CEACAM21 n/a
2 TRCN0000371716 GATGAAGCTGTCCTGGTTTAA pLKO_005 1034 CDS 100% 13.200 9.240 N CEACAM21 n/a
3 TRCN0000371717 ACAGCTATGGCTGGTACAAAG pLKO_005 572 5UTR 100% 10.800 7.560 N CEACAM21 n/a
4 TRCN0000146920 CCTACAAGTCACATACAGAAA pLKO.1 747 5UTR 100% 4.950 3.465 N CEACAM21 n/a
5 TRCN0000146921 CAAATAACACTGGAACCTCTT pLKO.1 970 CDS 100% 4.050 2.835 N CEACAM21 n/a
6 TRCN0000149489 GAATGTTCATCTCTCTGTGGT pLKO.1 531 5UTR 100% 2.640 1.848 N CEACAM21 n/a
7 TRCN0000147554 GCAGCATATGTAATAGACACT pLKO.1 622 5UTR 100% 0.000 0.000 N CEACAM21 n/a
8 TRCN0000150236 GCTAATCGCAGCATATGTAAT pLKO.1 615 5UTR 100% 0.000 0.000 N CEACAM21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527450.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04509 pDONR223 100% 54.8% 51.8% None (many diffs) n/a
2 ccsbBroad304_04509 pLX_304 0% 54.8% 51.8% V5 (many diffs) n/a
3 TRCN0000470437 TAATGCTCCATTTCGAGTAGACTA pLX_317 49.3% 54.8% 51.8% V5 (many diffs) n/a
Download CSV