Construct: ORF TRCN0000470460
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008344.1_s317c1
- Derived from:
- ccsbBroadEn_00675
- DNA Barcode:
- ATGTAAATTTGCTACCACATTGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR18 (2841)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470460
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2841 | GPR18 | G protein-coupled receptor 18 | NM_001098200.1 | 100% | 100% | |
| 2 | human | 2841 | GPR18 | G protein-coupled receptor 18 | NM_005292.3 | 100% | 100% | |
| 3 | human | 2841 | GPR18 | G protein-coupled receptor 18 | XM_006719946.3 | 100% | 100% | |
| 4 | human | 2841 | GPR18 | G protein-coupled receptor 18 | XM_024449339.1 | 100% | 100% | |
| 5 | mouse | 110168 | Gpr18 | G protein-coupled receptor 18 | NM_182806.1 | 82.5% | 85.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1059
- ORF length:
- 993
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat caccctgaac aatcaagatc aacctgtccc ttttaacagc tcacatccag 121 atgaatacaa aattgcagcc cttgtcttct atagctgtat cttcataatt ggattatttg 181 ttaacatcac tgcattatgg gttttcagtt gtaccaccaa gaagagaacc acggtaacca 241 tctatatgat gaatgtggca ttagtggact tgatatttat aatgacttta ccctttcgaa 301 tgttttatta tgcaaaagat gaatggccat ttggagagta cttctgccag attcttggag 361 ctctcacagt gttttaccca agcattgctt tatggcttct tgcctttatt agtgctgaca 421 gatacatggc cattgtacag ccgaagtacg ccaaagaact taaaaacacg tgcaaagccg 481 tgctggcgtg tgtgggagtc tggataatga ccctgaccac gaccacccct ctgctactgc 541 tctataaaga cccagataaa gactccactc ccgccacctg cctcaagatt tctgacatca 601 tctatctaaa agctgtgaac gtgctgaacc tcactcgact gacatttttt ttcttgattc 661 ctttgttcat catgattggg tgctacttgg tcattattca taatctcctt cacggCAGGA 721 CGTCTAAGCT GAAACCCAAA GTCAAGGAGA AGTCCATAAG GATCATCATC ACGCTGCTGG 781 TGCAGGTGCT CGTCTGCTTT ATGCCCTTCC ACATCTGTTT CGCTTTCCTG ATGCTGGGAA 841 CGGGGGAGAA CAGTTACAAT CCCTGGGGAG CCTTTACCAC CTTCCTCATG AACCTCAGCA 901 CGTGTCTGGA TGTGATTCTC TACTACATCG TTTCAAAACA ATTTCAGGCT CGAGTCATTA 961 GTGTCATGCT ATACCGTAAT TACCTTCGAA GCATGCGCAG AAAAAGTTTC CGATCTGGTA 1021 GTCTACGGTC ACTAAGCAAT ATAAACAGTG AAATGTTATG CACAACTTTC TTGTACAAAG 1081 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1141 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1201 ACGAATGTAA ATTTGCTACC ACATTGCCAC GCGTTAAGTC gacaatcaac ctctggatta 1261 caaaatttgt gaaagatt