Transcript: Human XM_024449339.1

PREDICTED: Homo sapiens G protein-coupled receptor 18 (GPR18), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR18 (2841)
Length:
2659
CDS:
1504..2499

Additional Resources:

NCBI RefSeq record:
XM_024449339.1
NBCI Gene record:
GPR18 (2841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357128 GCATTAGTGGACTTGATATTT pLKO_005 1696 CDS 100% 15.000 21.000 N GPR18 n/a
2 TRCN0000357201 TGTCATGCTATACCGTAATTA pLKO_005 2400 CDS 100% 15.000 21.000 N GPR18 n/a
3 TRCN0000357202 TGGTAGTCTACGGTCACTAAG pLKO_005 2454 CDS 100% 10.800 15.120 N GPR18 n/a
4 TRCN0000008831 CGAGTCATTAGTGTCATGCTA pLKO.1 2389 CDS 100% 3.000 4.200 N GPR18 n/a
5 TRCN0000008832 CCCTCTGCTACTGCTCTATAA pLKO.1 1965 CDS 100% 13.200 9.240 N GPR18 n/a
6 TRCN0000008833 GTGGCATTAGTGGACTTGATA pLKO.1 1693 CDS 100% 5.625 3.938 N GPR18 n/a
7 TRCN0000008830 CTTTCATTTCAATCCCATCAA pLKO.1 2511 3UTR 100% 4.950 3.465 N GPR18 n/a
8 TRCN0000008834 GCTGACAGATACATGGCCATT pLKO.1 1852 CDS 100% 4.050 2.835 N GPR18 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 36 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 36 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00675 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00675 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470460 ATGTAAATTTGCTACCACATTGCC pLX_317 34.9% 100% 100% V5 n/a
4 TRCN0000488802 CACTCGAACGATTGCGGAGCGCAC pLX_317 34% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489430 CCCAACCGCATTGCTCCAACCAAG pLX_317 11.6% 100% 100% V5 (not translated due to prior stop codon) n/a
6 TRCN0000489630 CGGCTAGCTAAGTAGCTTACCCTC pLX_317 37.2% 99.7% 100% V5 992_993delTA n/a
7 TRCN0000489340 ACGGAACGCCTTCGCTCTGAGTAT pLX_317 37.2% 99.7% 100% V5 992_993delTA n/a
Download CSV