Construct: ORF TRCN0000470476
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007927.1_s317c1
- Derived from:
- ccsbBroadEn_13936
- DNA Barcode:
- TTCCTACGCCAACAAACTTATATG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PTPRF (5792)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470476
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5792 | PTPRF | protein tyrosine phosphatas... | NM_001329138.1 | 18.8% | 15.7% | (many diffs) |
| 2 | human | 5792 | PTPRF | protein tyrosine phosphatas... | NM_001329137.1 | 18.8% | 15.7% | (many diffs) |
| 3 | human | 5792 | PTPRF | protein tyrosine phosphatas... | NM_001329140.1 | 18.6% | 15.6% | (many diffs) |
| 4 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_017001946.1 | 18.5% | 15.4% | (many diffs) |
| 5 | human | 5792 | PTPRF | protein tyrosine phosphatas... | NM_001329139.1 | 18.4% | 15.4% | (many diffs) |
| 6 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_017001949.1 | 18.4% | 15.4% | (many diffs) |
| 7 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710801.3 | 17.4% | 14.5% | (many diffs) |
| 8 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_017001944.1 | 16.8% | 13.9% | (many diffs) |
| 9 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710800.3 | 16.7% | 13.8% | (many diffs) |
| 10 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_005271082.3 | 16.7% | 13.9% | (many diffs) |
| 11 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710799.3 | 16.6% | 13.8% | (many diffs) |
| 12 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_017001945.1 | 16.6% | 13.8% | (many diffs) |
| 13 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_017001943.1 | 16.5% | 13.7% | (many diffs) |
| 14 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710798.3 | 15.9% | 13.2% | (many diffs) |
| 15 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710797.3 | 15.8% | 13.1% | (many diffs) |
| 16 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710796.3 | 15.8% | 13.1% | (many diffs) |
| 17 | human | 5792 | PTPRF | protein tyrosine phosphatas... | NM_130440.3 | 15.8% | 13.2% | (many diffs) |
| 18 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_005271079.3 | 15.7% | 13% | (many diffs) |
| 19 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_006710795.3 | 15.7% | 13% | (many diffs) |
| 20 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_011541871.3 | 15.7% | 13% | (many diffs) |
| 21 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_011541872.3 | 15.7% | 13% | (many diffs) |
| 22 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_011541873.2 | 15.7% | 13% | (many diffs) |
| 23 | human | 5792 | PTPRF | protein tyrosine phosphatas... | NM_002840.5 | 15.7% | 13.1% | (many diffs) |
| 24 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_005271081.3 | 15.7% | 13.1% | (many diffs) |
| 25 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_005271080.3 | 15.6% | 13% | (many diffs) |
| 26 | human | 5792 | PTPRF | protein tyrosine phosphatas... | XM_017001942.2 | 14.8% | 11.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1128
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ccctgagcca gccccaggga ggacgatggt gccccttgtg cctgcactgg 121 tgatgcttgg tttggtggca ggcgcccatg gtgacagcaa acctgtcttc attaaagtcc 181 ctgaggacca gactgggctg tcaggagggg tagcctcctt cgtgtgccaa gctacaggag 241 aacccaagcc gcgcatcaca tggatgaaga aggggaagaa agtcagctcc cagcgcttcg 301 aggtcattga gtttgatgat ggggcagggt cagtgcttcg gatccagcca ttgcgggtgc 361 agcgagatga agccatctat gagtgtacag ctactaacag cctgggtgag atcaacacta 421 gtgccaagct ctcagtgctc gaagaggaac agctgccccc tgggttccct tccatcgaca 481 tggggcctca gctgaaggtg gtggagaagg cacgcacagc caccatgcta tgtgccgcag 541 gcggaaatcc agaccctgag atttcttggt tcaaggactt ccttcctgta gaccctgcca 601 cgagcaacgg ccgcatcaag cagctgcgtt caggtggttc accaatcaga ggtgccttgc 661 agatagagag cagtgaggaa tccgaccaag gcaagtacga gtgtgtggcg accaactcgg 721 caggcacacg ttactcagcc ccTGCGAACC TGTATGTGCG AGGTAAGGAC TCAGGCAGTG 781 CCTGGCCCCT GTCACCACAG AGCTGTGCTG CACCTGCCGG GCTCTCTGCC CAGAGCCCTT 841 GGTGCAGACA CGCAAGGGAC TGCCATGGGC CCAGTCTCTT CTCCTTCCTG CTTCTTTCTG 901 CAGCAGCAGC AACAGCTCCC ACTGGGCAAG TTCCTGGCGT CTGCCACTAC TTCGCCTTCC 961 TTCCTTGCAG GCCCATGGGG AAGCAGCCAC TCTTGGGAGC ATTTGTATCT TTTGTAGGTC 1021 TTGCCGCATG GGCCCGGAGC CCCATGGGAA TTTGGAGCCA TCCAATCCGA CTTCTTGGTG 1081 TATGTGCATG TGTGTGTGCA CACACGGGCA CACTTATCTG TGGTGTACCC AACTTTCTTG 1141 TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG 1201 TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT 1261 GGAAAGGACG ATTCCTACGC CAACAAACTT ATATGACGCG TTAAGTCgac aatcaacctc 1321 tggattacaa aatttgtgaa agatt