Transcript: Human XM_017001944.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type F (PTPRF), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRF (5792)
Length:
7422
CDS:
357..5759

Additional Resources:

NCBI RefSeq record:
XM_017001944.1
NBCI Gene record:
PTPRF (5792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381040 CTCAGCCCTTTCTCGGAATAT pLKO_005 1503 CDS 100% 13.200 18.480 N PTPRF n/a
2 TRCN0000002856 GTCAGGTGGTTCTACATTGTT pLKO.1 3420 CDS 100% 5.625 7.875 N PTPRF n/a
3 TRCN0000279927 GTCAGGTGGTTCTACATTGTT pLKO_005 3420 CDS 100% 5.625 7.875 N PTPRF n/a
4 TRCN0000379405 ACCGAGACCTGTGGCCTTATT pLKO_005 4440 CDS 100% 13.200 9.240 N PTPRF n/a
5 TRCN0000380357 GAGGTTCCCGACTCCTATAAG pLKO_005 3132 CDS 100% 13.200 9.240 N PTPRF n/a
6 TRCN0000002855 CTTCTATCAATGGTACTCTAA pLKO.1 7066 3UTR 100% 4.950 3.465 N PTPRF n/a
7 TRCN0000297277 CTTCTATCAATGGTACTCTAA pLKO_005 7066 3UTR 100% 4.950 3.465 N PTPRF n/a
8 TRCN0000002857 GCGATCACAGAGGAACTACAT pLKO.1 4784 CDS 100% 4.950 3.465 N PTPRF n/a
9 TRCN0000279926 GCGATCACAGAGGAACTACAT pLKO_005 4784 CDS 100% 4.950 3.465 N PTPRF n/a
10 TRCN0000002859 CTTTACCCTTACTGGCCTCAA pLKO.1 2951 CDS 100% 4.050 2.835 N PTPRF n/a
11 TRCN0000279925 CTTTACCCTTACTGGCCTCAA pLKO_005 2951 CDS 100% 4.050 2.835 N PTPRF n/a
12 TRCN0000238012 CACCCATGCCCTACGTGAAAT pLKO_005 1141 CDS 100% 13.200 9.240 N Ptprs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15555 pDONR223 0% 16.8% 13% None (many diffs) n/a
2 ccsbBroad304_15555 pLX_304 0% 16.8% 13% V5 (many diffs) n/a
3 ccsbBroadEn_13936 pDONR223 100% 16.8% 13.9% None (many diffs) n/a
4 ccsbBroad304_13936 pLX_304 0% 16.8% 13.9% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000470476 TTCCTACGCCAACAAACTTATATG pLX_317 36.4% 16.8% 13.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV