Construct: ORF TRCN0000470505
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017077.1_s317c1
- Derived from:
- ccsbBroadEn_10516
- DNA Barcode:
- TATAGCGGCAAGTTATAAGGCGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GMCL2 (64396)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470505
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64396 | GMCL2 | germ cell-less 2, spermatog... | NM_001358008.2 | 99.6% | 99.2% | (many diffs) |
| 2 | human | 64395 | GMCL1 | germ cell-less 1, spermatog... | NM_178439.5 | 92.7% | 88.7% | (many diffs) |
| 3 | human | 64395 | GMCL1 | germ cell-less 1, spermatog... | XM_011533033.2 | 84.3% | 80.6% | (many diffs) |
| 4 | human | 64395 | GMCL1 | germ cell-less 1, spermatog... | XM_011533034.2 | 60% | 57% | (many diffs) |
| 5 | human | 64395 | GMCL1 | germ cell-less 1, spermatog... | XM_017004704.2 | 60% | 57% | (many diffs) |
| 6 | human | 64395 | GMCL1 | germ cell-less 1, spermatog... | XM_017004705.1 | 56.6% | 54.5% | (many diffs) |
| 7 | human | 64395 | GMCL1 | germ cell-less 1, spermatog... | XR_001738895.2 | 35.1% | (many diffs) | |
| 8 | mouse | 23885 | Gmcl1 | germ cell-less, spermatogen... | NM_011818.3 | 84.2% | 84.2% | (many diffs) |
| 9 | mouse | 23885 | Gmcl1 | germ cell-less, spermatogen... | XM_006506056.2 | 47.1% | 47.5% | (many diffs) |
| 10 | mouse | 23885 | Gmcl1 | germ cell-less, spermatogen... | XR_377446.3 | 42.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1644
- ORF length:
- 1578
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg atcgtcgagc agccgggtgc tgggccagcc gaggcgagcc cttgcccagc 121 aggaacaggg tgccagggcc aggggctcgg cccggaggcc ggacactgga gacgatgcgg 181 cgagctacgg cttctgttac tgcccgggca gtcacaagcg caagcggagc agcggggcct 241 gccgctactg tgacccggac tcgcacaggg aggagcatga ggaggagggg gacaagcagc 301 agccgctcct caacacccct gcaaggaaaa aattaaggag tacatccaaa tatatttatc 361 aaacattatt tttgaatggt gaaaacagtg acattaagat ttgtgctcta ggagaagaat 421 ggcgattaca caaaatatat ttatgtcaat ctggctactt ttctagtatg ttcagtggtt 481 cttggaaaga atccagcatg aatattattg aactggagat tcctgaccag aacattgatg 541 tagacgcact gcaggttgcg tttggttcac tgtatcgaga tgatgtcttg ataaaaccca 601 gtcgagttgt tgccattttg gcagcagctt gtatgctgca gctggatggt ttaatacagc 661 agtgtggtga gacaatgaag gaaacaatta atgtgaaaac tgtatgcggt tattacacat 721 cagtagagat ctatggatta gattctgtaa agaaaaagtg ccttgaatgg cttctaaaca 781 atttgatgac tcaccagaat gttaaacttt ttaaagaact cggtataaat gtcatgaaac 841 agctcattgg ttcctctaac ttatttgtga tgcaagtgga gatggatgta tacaccactc 901 taaaaaagtg gatgttcctt caacttgtgc cttcttggaa tggatcttta aaacagcttt 961 tgacagaaac agatgtctgg ttttctaaac agagaaaaga ttttgaaggt atggcctttc 1021 ttgaaactga accaggaaaa ccatttgtgt cagtattcag acatttaagg ttacaatata 1081 ttatcagtga cctagcttct gcaagaatta ttgaacaaga tggtatagta ccttcagaat 1141 ggctgtcttc tgtgtataaa cagcagtggt ttgctatgct gcgggCAGAA CAAGACCATG 1201 AGGTAGGGCC TCAAGAAATC AATAAAGAAG ACCTAGAGGG AAGTAGCATG AGGTGTGGTA 1261 GAAAGCTTGC CAAAGATGGT GAATACTACT GGTGTTGGAC GGGTTTTAAC TTCGGCTTTG 1321 ACCTACTTGT AATTTACACC AATGGATACA TCATTTTCAA ACGCAATACA CTGAATCAGC 1381 CATGCAGCGG GTCTGTCAGT TTACGGCCTC GAAGGAGCAT AGCATTTAGA TTACGCTTGG 1441 CTTCTTTTGA TAGTAGTGGA AAACTAGTAT GTAGTAGAAC AACTGGCTAT CAAATACTTA 1501 TACTTAAAAA GGATCAGGAA CAAGTGGTGA TGAACTTGGA CAGCAGGTTT CTGACCTTCC 1561 CTTTATATAT CTGCTGTAAC TTCTTGTATA TATCACCAGA AAAAGGAATT GAAAATAATC 1621 GCCACCCAGA AGATCCAGAA AACTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1681 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1741 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT ATAGCGGCAA 1801 GTTATAAGGC GTTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1861 att