Construct: ORF TRCN0000470572
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013156.1_s317c1
- Derived from:
- ccsbBroadEn_06785
- DNA Barcode:
- ATGCAGTTCGTCAATATCTATCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRSS2 (5645)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470572
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5645 | PRSS2 | serine protease 2 | NM_002770.4 | 99.5% | 99.5% | 8T>C;12T>C;270G>A |
2 | human | 5645 | PRSS2 | serine protease 2 | NM_001303414.1 | 94.2% | 94.2% | (many diffs) |
3 | human | 5646 | PRSS3 | serine protease 3 | NM_002771.3 | 93.5% | 89% | (many diffs) |
4 | human | 5644 | PRSS1 | serine protease 1 | NM_002769.5 | 93.2% | 89.8% | (many diffs) |
5 | human | 5646 | PRSS3 | serine protease 3 | NM_001197098.1 | 89% | 86.2% | (many diffs) |
6 | human | 5646 | PRSS3 | serine protease 3 | NM_001197097.2 | 85.9% | 80.8% | (many diffs) |
7 | human | 5645 | PRSS2 | serine protease 2 | NR_130149.2 | 82% | (many diffs) | |
8 | human | 154754 | PRSS3P2 | PRSS3 pseudogene 2 | NR_001296.3 | 80.8% | (many diffs) | |
9 | human | 5646 | PRSS3 | serine protease 3 | NM_007343.3 | 74.8% | 71% | (many diffs) |
10 | human | 5646 | PRSS3 | serine protease 3 | XM_011517965.1 | 68.6% | 61.8% | (many diffs) |
11 | human | 5644 | PRSS1 | serine protease 1 | XM_011516411.1 | 48.7% | 47% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 810
- ORF length:
- 741
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatccactc ctgatcctta cctttgttgc agctgctgtt gctgccccct 121 ttgatgatga tgacaagatc gttgggggct acatctgtga ggagaattct gtcccctacc 181 aggtgtcctt gaattctggc taccacttct gcggtggctc cctcatcagc gaacagtggg 241 tggtgtcagc aggtcactgc tacaagtccc gcatccaggt gagactggga gagcacaaca 301 tcgaagtcct ggaggggaat gaacagttca tcaatgcagc caagatcatc cgccacccca 361 aatacaacag ccggactctg gacaatgaca tccTGCTGAT CAAGCTCTCC TCACCTGCCG 421 TCATCAATTC CCGCGTGTCC GCCATCTCTC TGCCCACTGC CCCTCCAGCT GCTGGCACCG 481 AGTCCCTCAT CTCCGGCTGG GGCAACACTC TGAGTTCTGG TGCCGACTAC CCAGACGAGC 541 TGCAGTGCCT GGATGCTCCT GTGCTGAGCC AGGCTGAGTG TGAAGCCTCC TACCCTGGAA 601 AGATTACCAA CAACATGTTC TGTGTGGGCT TCCTCGAGGG AGGCAAGGAT TCCTGCCAGG 661 GTGATTCTGG TGGCCCTGTG GTCTCCAATG GAGAGCTCCA AGGAATTGTC TCCTGGGGCT 721 ATGGCTGTGC CCAGAAGAAC AGGCCTGGAG TCTACACCAA GGTCTACAAC TATGTGGACT 781 GGATTAAGGA CACCATAGCT GCCAACAGCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 841 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 901 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATGCA 961 GTTCGTCAAT ATCTATCTTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1021 tgaaagatt