Construct: ORF TRCN0000470590
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002675.1_s317c1
- Derived from:
- ccsbBroadEn_02681
- DNA Barcode:
- CCTACTGAGAACGAGATCAGCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MGLL (11343)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470590
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11343 | MGLL | monoglyceride lipase | NM_007283.6 | 100% | 100% | |
2 | human | 11343 | MGLL | monoglyceride lipase | NM_001003794.2 | 96.8% | 96.8% | 0_1ins30 |
3 | human | 11343 | MGLL | monoglyceride lipase | XM_011512377.2 | 92.3% | 92.3% | 510_587del |
4 | human | 11343 | MGLL | monoglyceride lipase | NM_001256585.1 | 90.4% | 90.4% | 508_509ins90 |
5 | human | 11343 | MGLL | monoglyceride lipase | XM_011512378.2 | 89.3% | 89.3% | 0_1ins30;480_557del |
6 | human | 11343 | MGLL | monoglyceride lipase | XM_017005666.2 | 87.2% | 87.2% | 0_1ins30;478_479ins90 |
7 | human | 11343 | MGLL | monoglyceride lipase | XM_017005662.2 | 86.9% | 79.7% | (many diffs) |
8 | human | 11343 | MGLL | monoglyceride lipase | XM_017005664.2 | 79.5% | 75.3% | (many diffs) |
9 | human | 11343 | MGLL | monoglyceride lipase | XM_017005665.1 | 79.5% | 75.3% | (many diffs) |
10 | human | 11343 | MGLL | monoglyceride lipase | XM_024453333.1 | 79.5% | 75.3% | (many diffs) |
11 | human | 11343 | MGLL | monoglyceride lipase | XM_024453334.1 | 76.6% | 76.6% | 0_1ins219 |
12 | human | 11343 | MGLL | monoglyceride lipase | XM_011512379.2 | 73.6% | 69.6% | (many diffs) |
13 | human | 11343 | MGLL | monoglyceride lipase | XM_011512382.1 | 70.7% | 70.7% | 0_1ins219;291_368del |
14 | human | 11343 | MGLL | monoglyceride lipase | XM_017005663.1 | 70.7% | 60% | (many diffs) |
15 | human | 11343 | MGLL | monoglyceride lipase | XM_011512383.2 | 70.2% | 65.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1005
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga aacaggacct gaagaccctt ccagcatgcc agaggaaagt tcccccaggc 121 ggaccccgca gagcattccc taccaggacc tccctcacct ggtcaatgca gacggacagt 181 acctcttctg caggtactgg aaacccacag gcacacccaa ggccctcatc tttgtgtccc 241 atggagccgg agagcacagt ggccgctatg aagagctggc tcggatgctg atggggctgg 301 acctgctggt gttcgcccac gaccatgttg gccacggaca gagcgaaggg gagaggatgg 361 tagtgtctga cttccacgtt ttcgtcaggg atgtgttgca gcatgtggat tccatgcaga 421 aagactaccc tgggcttcct gtcttccttc tgggccactc catgggaggc gccatcgcca 481 tcctcacggc cgcagagagg ccgggccact tcgccggcat ggtactcatt tcgcctctgg 541 ttcttgccaa tcctgaatct gcaacaactt tcaaggtcct tgctgcgaaa gtgctcaacc 601 ttgtgctgcc aaacttgtcc ctcgggccca tcgactccag cgtgctctct cggaataaga 661 cagaggtcga catttataac tcagaccccc TGATCTGCCG GGCAGGGCTG AAGGTGTGCT 721 TCGGCATCCA ACTGCTGAAT GCCGTCTCAC GGGTGGAGCG CGCCCTCCCC AAGCTGACTG 781 TGCCCTTCCT GCTGCTCCAG GGCTCTGCCG ATCGCCTATG TGACAGCAAA GGGGCCTACC 841 TGCTCATGGA GTTAGCCAAG AGCCAGGACA AGACTCTCAA GATTTATGAA GGTGCCTACC 901 ATGTTCTCCA CAAGGAGCTT CCTGAAGTCA CCAACTCCGT CTTCCATGAA ATAAACATGT 961 GGGTCTCTCA AAGGACAGCC ACGGCAGGAA CTGCGTCCCC ACCCTGCCCA ACTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA CCTACTGAGA ACGAGATCAG CTTCACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt