Transcript: Human XM_011512383.2

PREDICTED: Homo sapiens monoglyceride lipase (MGLL), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGLL (11343)
Length:
4212
CDS:
337..1080

Additional Resources:

NCBI RefSeq record:
XM_011512383.2
NBCI Gene record:
MGLL (11343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032827 GCCCTCATCTTTGTGTCCCAT pLKO.1 196 5UTR 100% 2.640 3.696 N Mgll n/a
2 TRCN0000350826 AGACACTGGACCTACCTTAAT pLKO_005 1256 3UTR 100% 13.200 9.240 N MGLL n/a
3 TRCN0000048711 CAACTCCGTCTTCCATGAAAT pLKO.1 1005 CDS 100% 13.200 9.240 N MGLL n/a
4 TRCN0000331408 CAACTCCGTCTTCCATGAAAT pLKO_005 1005 CDS 100% 13.200 9.240 N MGLL n/a
5 TRCN0000048712 CCAATCCTGAATCTGCAACAA pLKO.1 710 CDS 100% 4.950 3.465 N MGLL n/a
6 TRCN0000301053 CCAATCCTGAATCTGCAACAA pLKO_005 710 CDS 100% 4.950 3.465 N MGLL n/a
7 TRCN0000048708 CCAGGACAAGACTCTCAAGAT pLKO.1 936 CDS 100% 4.950 2.970 N MGLL n/a
8 TRCN0000301052 CCAGGACAAGACTCTCAAGAT pLKO_005 936 CDS 100% 4.950 2.970 N MGLL n/a
9 TRCN0000048709 GCATGTGGATTCCATGCAGAA pLKO.1 564 CDS 100% 0.405 0.243 N MGLL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02681 pDONR223 100% 70.2% 65.9% None (many diffs) n/a
2 ccsbBroad304_02681 pLX_304 0% 70.2% 65.9% V5 (many diffs) n/a
3 TRCN0000470590 CCTACTGAGAACGAGATCAGCTTC pLX_317 33.8% 70.2% 65.9% V5 (many diffs) n/a
4 TRCN0000489305 CAAAAAAAAAAACCAAACAGTCCG pLX_317 33.9% 70.2% 65.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV