Construct: ORF TRCN0000470608
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008495.1_s317c1
- Derived from:
- ccsbBroadEn_09354
- DNA Barcode:
- TTCGTATAGTTAACCAACCTCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IGSF8 (93185)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470608
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | NM_001206665.2 | 100% | 100% | |
| 2 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | NM_001320247.2 | 100% | 100% | |
| 3 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | NM_052868.6 | 100% | 100% | |
| 4 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_017002835.1 | 100% | 100% | |
| 5 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_017002836.1 | 100% | 100% | |
| 6 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_017002837.1 | 100% | 100% | |
| 7 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_006711631.3 | 96.5% | 96.5% | 0_1ins57;5_11delGACTCAAinsT |
| 8 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_024450945.1 | 96.5% | 96.5% | 0_1ins57;5_11delGACTCAAinsT |
| 9 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_017002838.1 | 96.4% | 96.4% | 0_1ins66 |
| 10 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_017002839.1 | 96.4% | 96.4% | 0_1ins66 |
| 11 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_017002840.2 | 96.4% | 96.4% | 0_1ins66 |
| 12 | human | 93185 | IGSF8 | immunoglobulin superfamily ... | XM_024450947.1 | 96.4% | 96.4% | 0_1ins66 |
| 13 | mouse | 140559 | Igsf8 | immunoglobulin superfamily,... | NM_080419.2 | 85.4% | 88.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1905
- ORF length:
- 1839
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cgccctcagg cccacgctgc tgccgccttc gctgccgctg ctgctgctgc 121 taatgctagg aatgggatgc tgggcccggg aggtgctggt ccccgagggg cccttgtacc 181 gcgtggctgg cacagctgtc tccatctcct gcaatgtgac cggctatgag ggccctgccc 241 agcagaactt cgagtggttc ctgtataggc ccgaggcccc agatactgca ctgggcattg 301 tcagtaccaa ggatacccag ttctcctatg ctgtcttcaa gtcccgagtg gtggcgggtg 361 aggtgcaggt gcagcgccta caaggtgatg ccgtggtgct caagattgcc cgcctgcagg 421 cccaggatgc cggcatttat gagtgccaca ccccctccac tgatacccgc tacctgggca 481 gctacagcgg caaggtggag ctgagagttc ttccagatgt cctccaggtg tctgctgccc 541 ccccagggcc ccgaggccgc caggccccaa cctcaccccc acgcatgacg gtgcatgagg 601 ggcaggagct ggcactgggc tgcctggcga ggacaagcac acagaagcac acacacctgg 661 cagtgtcctt tgggcgatct gtgcccgagg caccagttgg gcggtcaact ctgcaggaag 721 tggtgggaat ccggtcagac ttggccgtgg aggctggagc tccctatgct gagcgattgg 781 ctgcagggga gcttcgtctg ggcaaggaag ggaccgatcg gtaccgcatg gtagtagggg 841 gtgcccaggc aggggacgca ggcacctacc actgcactgc cgctgagtgg attcaggatc 901 ctgatggcag ctgggcccag attgcagaga aaagggccgt cctggcccac gtggatgtgc 961 agacgctgtc cagccagctg gcagtgacag tggggcctgg tgaacgtcgg atcggcccag 1021 gggagccctt ggaactgctg tgcaatgtgt caggggcact tcccccagca ggccgtcatg 1081 ctgcatactc tgtaggttgg gagatggcac ctgcgggggc acctgggccc ggccgcctgg 1141 tagcccagct ggacacagag ggtgtgggca gcctgggccc tggctatgag ggccgacaca 1201 ttgccatgga gaaggtggca tccagaacat accggctacg gctagaggct gccaggcctg 1261 gtgatgcggg cacctaccgc tgcctcgcca aagcctatgt tcgagggtct gggacccggc 1321 ttcgtgaagc agccagtgcc cgttcccggc ctctccctgt acatgtgcgg gaggaaggtg 1381 tggtgctgga ggctgtggca tggctagcag gaggcacagt gtaccgcggg gagactgcct 1441 ccctgctgtg caacatctct gtgcggggtg gccccccagg actgcggctg gccgccagct 1501 ggtgggtgga gcgaccagag gacggagagc tcagctctgt ccctgcccag ctggtgggtg 1561 gcgtaggcca ggatggtgtg gcagagctgg gagtccggcc tggaggaggc cCTGTCAGCG 1621 TAGAGCTGGT GGGGCCCCGA AGCCATCGGC TGAGACTACA CAGCTTGGGG CCCGAGGATG 1681 AAGGCGTGTA CCACTGTGCC CCCAGCGCCT GGGTGCAGCA TGCCGACTAC AGCTGGTACC 1741 AGGCGGGCAG TGCCCGCTCA GGGCCTGTTA CAGTCTACCC CTACATGCAT GCCCTGGACA 1801 CCCTATTTGT GCCTCTGCTG GTGGGTACAG GGGTGGCCCT AGTCACTGGT GCCACTGTCC 1861 TTGGTACCAT CACTTGCTGC TTCATGAAGA GGCTTCGAAA ACGGTGCCCA ACTTTCTTGT 1921 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1981 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2041 GAAAGGACGA TTCGTATAGT TAACCAACCT CCCCACGCGT TAAGTCgaca atcaacctct 2101 ggattacaaa atttgtgaaa gatt