Transcript: Human NM_001320247.2

Homo sapiens immunoglobulin superfamily member 8 (IGSF8), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
IGSF8 (93185)
Length:
2293
CDS:
148..1989

Additional Resources:

NCBI RefSeq record:
NM_001320247.2
NBCI Gene record:
IGSF8 (93185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431504 TGCCTCGCCAAAGCCTATGTT pLKO_005 1363 CDS 100% 5.625 3.938 N IGSF8 n/a
2 TRCN0000057079 CCAGTTCTCCTATGCTGTCTT pLKO.1 399 CDS 100% 4.950 3.465 N IGSF8 n/a
3 TRCN0000057078 GCTGCTGCTAATGCTAGGAAT pLKO.1 195 CDS 100% 4.950 3.465 N IGSF8 n/a
4 TRCN0000057080 GCTTCATGAAGAGGCTTCGAA pLKO.1 1961 CDS 100% 3.000 2.100 N IGSF8 n/a
5 TRCN0000057081 CCTGTACATGTGCGGGAGGAA pLKO.1 1438 CDS 100% 0.880 0.616 N IGSF8 n/a
6 TRCN0000057082 CTGTCCTTGGTACCATCACTT pLKO.1 1937 CDS 100% 0.000 0.000 N IGSF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09354 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09354 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470608 TTCGTATAGTTAACCAACCTCCCC pLX_317 16.3% 100% 100% V5 n/a
Download CSV