Construct: ORF TRCN0000470674
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000730.1_s317c1
- Derived from:
- ccsbBroadEn_12721
- DNA Barcode:
- CCGCAGTCCCCTTCGCCGGAGATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GFOD2 (81577)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470674
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81577 | GFOD2 | glucose-fructose oxidoreduc... | XM_006721288.4 | 100% | 100% | |
| 2 | human | 81577 | GFOD2 | glucose-fructose oxidoreduc... | NM_030819.4 | 72.7% | 72.7% | 1_315del |
| 3 | human | 81577 | GFOD2 | glucose-fructose oxidoreduc... | NR_027398.2 | 50.2% | 1_210del;1051_1672del | |
| 4 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_006531352.3 | 85.6% | 94% | (many diffs) |
| 5 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_006531350.3 | 77.7% | 85.3% | (many diffs) |
| 6 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_017312959.1 | 77.7% | 85.3% | (many diffs) |
| 7 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | NM_027469.4 | 63.3% | 69.6% | (many diffs) |
| 8 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_017312958.1 | 63.3% | 69.6% | (many diffs) |
| 9 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_006531347.3 | 57.4% | 63% | (many diffs) |
| 10 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_006531348.3 | 57.4% | 63% | (many diffs) |
| 11 | mouse | 70575 | Gfod2 | glucose-fructose oxidoreduc... | XM_011248499.2 | 57.4% | 63% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 906
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gacagcctcg cgctactacc cgcagctcat gagcctggta gggaacgtgc 121 tgcgcttcct gcctgccttc gtgcgcatga aacagctgat ttcggaacac tatgtgggag 181 cggtgatgat ctgtgatgcc cgcatctact caggcagcct gctgagcccc agctatggct 241 ggatctgtga tgagctcatg ggcggcgggg gcttgcacac catggggacc tacattgtgg 301 acctgctgac ccacctgacc ggccggagag ccgagaaggt gcacgggctg ctcaagacat 361 tcgtgaggca gaacgctgcc atccgtggca tccggcacgt cactagcgat gacttctgtt 421 tcttccagat gctcatgggt gggggtgtgt gtagcacagt gacactcaac ttcaacatgC 481 CAGGCGCCTT TGTGCATGAA GTCATGGTGG TAGGCTCTGC AGGACGCCTC GTCGCCCGGG 541 GAGCCGACCT CTATGGGCAG AAGAACTCTG CCACGCAAGA GGAGCTGCTC TTGAGGGACT 601 CGCTGGCAGT GGGCGCAGGA CTGCCTGAGC AGGGGCCCCA GGATGTCCCG CTGCTGTACC 661 TGAAGGGCAT GGTCTACATG GTGCAGGCCT TGCGCCAGTC CTTCCAGGGG CAGGGCGACC 721 GCCGCACCTG GGACCGCACC CCTGTCTCCA TGGCCGCCTC CTTCGAGGAT GGGCTGTACA 781 TGCAGAGCGT GGTGGATGCC ATCAAGAGGT CGAGCCGATC CGGGGAGTGG GAGGCTGTGG 841 AGGTGCTGAC GGAGGAGCCC GACACCAACC AGAACCTGTG TGAGGCACTT CAGCGGAACA 901 ACCTATGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACCGCAGTCC CCTTCGCCGG AGATCACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt