Transcript: Mouse XM_017312959.1

PREDICTED: Mus musculus glucose-fructose oxidoreductase domain containing 2 (Gfod2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gfod2 (70575)
Length:
4054
CDS:
404..1348

Additional Resources:

NCBI RefSeq record:
XM_017312959.1
NBCI Gene record:
Gfod2 (70575)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295087 ATTCGAGGACGGACTGTATAT pLKO_005 1201 CDS 100% 13.200 18.480 N Gfod2 n/a
2 TRCN0000099389 GAGCGTGGTAGATGCTATTAA pLKO.1 1225 CDS 100% 15.000 10.500 N Gfod2 n/a
3 TRCN0000287666 GAGCGTGGTAGATGCTATTAA pLKO_005 1225 CDS 100% 15.000 10.500 N Gfod2 n/a
4 TRCN0000099387 CTTGAAAGGTATGGTCTATAT pLKO.1 1099 CDS 100% 13.200 9.240 N Gfod2 n/a
5 TRCN0000287665 CTTGAAAGGTATGGTCTATAT pLKO_005 1099 CDS 100% 13.200 9.240 N Gfod2 n/a
6 TRCN0000295086 TTAGGGTAGATGGCAAGAAAC pLKO_005 1724 3UTR 100% 10.800 7.560 N Gfod2 n/a
7 TRCN0000099388 CCAGATGCCAACCAGAATCTA pLKO.1 1298 CDS 100% 5.625 3.938 N Gfod2 n/a
8 TRCN0000099385 GCAGGGCCAATGAAGATCAAT pLKO.1 1632 3UTR 100% 5.625 3.938 N Gfod2 n/a
9 TRCN0000099386 CCAACCAGAATCTAAGTGAAA pLKO.1 1305 CDS 100% 4.950 3.465 N Gfod2 n/a
10 TRCN0000064372 CCTGCCTTCGTGCGCATGAAA pLKO.1 572 CDS 100% 1.875 1.313 N GFOD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12721 pDONR223 100% 77.7% 85.3% None (many diffs) n/a
2 ccsbBroad304_12721 pLX_304 0% 77.7% 85.3% V5 (many diffs) n/a
3 TRCN0000470674 CCGCAGTCCCCTTCGCCGGAGATC pLX_317 50.8% 77.7% 85.3% V5 (many diffs) n/a
Download CSV