Construct: ORF TRCN0000470699
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017424.1_s317c1
- Derived from:
- ccsbBroadEn_02770
- DNA Barcode:
- GTTCCCTTATTGAATTCTAGTAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANGPTL2 (23452)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470699
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23452 | ANGPTL2 | angiopoietin like 2 | NM_012098.3 | 100% | 100% | |
| 2 | human | 23452 | ANGPTL2 | angiopoietin like 2 | XM_006717030.4 | 55.4% | 55.3% | 819delA;821T>C;822_823ins658 |
| 3 | mouse | 26360 | Angptl2 | angiopoietin-like 2 | NM_011923.4 | 89.3% | 95.3% | (many diffs) |
| 4 | mouse | 26360 | Angptl2 | angiopoietin-like 2 | XM_006498051.1 | 89.3% | 95.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1545
- ORF length:
- 1479
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gccactgtgc gtgacatgct ggtggctcgg actgctggct gccatgggag 121 ctgttgcagg ccaggaggac ggttttgagg gcactgagga gggctcgcca agagagttca 181 tttacctaaa caggtacaag cgggcgggcg agtcccagga caagtgcacc tacaccttca 241 ttgtgcccca gcagcgggtc acgggtgcca tctgcgtcaa ctccaaggag cctgaggtgc 301 ttctggagaa ccgagtgcat aagcaggagc tagagctgct caacaatgag ctgctcaagc 361 agaagcggca gatcgagacg ctgcagcagc tggtggaggt ggacggcggc attgtgagcg 421 aggtgaagct gctgcgcaag gagagccgca acatgaactc gcgggtcacg cagctctaca 481 tgcagctcct gcacgagatc atccgcaagc gggacaacgc gttggagctc tcccagctgg 541 agaacaggat cctgaaccag acagccgaca tgctgcagct ggccagcaag tacaaggacc 601 tggagcacaa gtaccagcac ctggccacac tggcccacaa ccaatcagag atcatcgcgc 661 agcttgagga gcactgccag agggtgccct cggccaggcc cgtcccccag ccaccccccg 721 ctgccccgcc ccgggtctac caaccaccca cctacaaccg catcatcaac cagatctcta 781 ccaacgagat ccagagtgac cagaacctga aggtgctgcc accccctctg cccactatgc 841 ccactctcac cagcctccca tcttccaccg acaagccgtc gggcccatgg agagactgcc 901 tgcaggccct ggaggatggc cacgacacca gctccatcta cctggtgaag ccggagaaca 961 ccaaccgcct catgcaggtg tggtgcgacc agagacacga ccccgggggc tggaccgtca 1021 tccagagacg cctggatggc tctgttaact tcttcaggaa ctgggagacg tacaagcaag 1081 ggtttgggaa cattgacggc gaatactggc tgggcctgga gaacatttac tggctgacga 1141 accaaggcaa ctacaaactc ctggtgacca tggaggactg gtccggccgc aaagtctttg 1201 cagaatacgc cagttTCCGC CTGGAACCTG AGAGCGAGTA TTATAAGCTG CGGCTGGGGC 1261 GCTACCATGG CAATGCGGGT GACTCCTTTA CATGGCACAA CGGCAAGCAG TTCACCACCC 1321 TGGACAGAGA TCATGATGTC TACACAGGAA ACTGTGCCCA CTACCAGAAG GGAGGCTGGT 1381 GGTATAACGC CTGTGCCCAC TCCAACCTCA ACGGGGTCTG GTACCGCGGG GGCCATTACC 1441 GGAGCCGCTA CCAGGACGGA GTCTACTGGG CTGAGTTCCG AGGAGGCTCT TACTCACTCA 1501 AGAAAGTGGT GATGATGATC CGACCGAACC CCAACACCTT CCACTACCCA ACTTTCTTGT 1561 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1621 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1681 GAAAGGACGA GTTCCCTTAT TGAATTCTAG TAACACGCGT TAAGTCgaca atcaacctct 1741 ggattacaaa atttgtgaaa gatt